MedWorm: Bioinformaticians

Palin

Blind.Scientist — Sun, 07 Feb 2010 21:42:18 +0100

Sarah Palin is the closest you can get to a populist Latin American president, such as Lula, the Kirchners, Chavez, etc. If you live in US, raise your hands to heaven and thank whoever that you don’t live in Latin American. You can get the taste. (Source: Blind.Scientist)

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

I Really need to sleep: inserting the SNPs into MongoDB with C++

YOKOFAKUN — Sun, 07 Feb 2010 00:00:00 +0100

In the previous post I showed how to parse dbSNP/XML with libxml. In the current post I'll insert the results into MongoDB using the native Mongo C++ API. Some others have already posted about MongoDB: for example see Jan's, Brad's or Neil's posts The Boost-C++library is required: my code failed to compile with boost 4.* but it compiled fine with boost 3.9.Starting mongoDB> mkdir ~/tmp/MONGODB/ (Source: YOKOFAKUN)

Id rather bee sleeping: fast parsing of dbsnp/XML with libxml

YOKOFAKUN — Sun, 07 Feb 2010 00:00:00 +0100

Hello world ! I'm now in Japan for Biohackathon 2010 it's 00H30 here and, of course, I cannot sleep. I should be tired : I spent 11H00 in a plane, 1H30 in a train and three hours skating in Tokyo with my kick scooter :-)I'm killing the time with libxml, the C library for parsing XML. In the current post I'll write a simple SAX parser extracting the flanking sequences from the SNPs of dbSNP/ (Source: YOKOFAKUN)

The distributed web of data – messaging included

business|bytes|genes|molecules — Sat, 06 Feb 2010 23:05:03 +0100

I’ve written about the distributed self and science data platforms. A lot of the former was around the notion of pubsub, and pushing data to various places. Now imagine a scenario where you are using data from a variety of scientific repositories and you’ve built applications that use APIs to collect data. What if your data sources would update you everytime there was a change, so that your systems could automatically fetch any updates and rebuild anything that needed to be rebuilt, do any pre-computing that needed to be done. The model that Anil Dash talked about in his classic Push-Button Web post is relevant here as well. We have the tools to do this today. Real time, asynchronous messaging is part of distributed computing, and the variety of data repositories out there sho...

Laboratory Walkover: a pitch for a TV show

Blind.Scientist — Sat, 06 Feb 2010 20:55:28 +0100

I can count in one hand how many times I’ve ever been in a ultra organized scientific lab. In some of them I don’t know how people work and are able to publish results obtained in the lab. Because of that and inspired by the countless reality TV shows, I decided to start pitching the idea of the Laboratory Walkover. We will come to your lab with a TV crew, a interior designer and a high level authority in your field of research and we are going to stop to nothing to make your lab the best research space on earth. You won’t need to pay a dime for the makeover/walkover/takeover, on the contrary we will give you $5000 for consumables and a new PCR machine (if applicable). I’m already looking for sponsors and channels, and if you want your lab o qualify for the walkover...

Science Commons Symposium Pacific Northwest – Discount Codes

business|bytes|genes|molecules — Fri, 05 Feb 2010 15:54:12 +0100

There is a stellar lineup of speakers at the forthcoming Science Commons Symposium here in the Seattle area (actually in Redmond). The announcement is below. bbgm readers in Seattle can use the code bbgmto get a discount on the tickets In the spirit of Creative Commons Salons — global, informal events focused on bringing together the community around a central topic or focus — Science Commons will be holding a day-long event this February in Seattle. The event will aim to bring a broader understanding on the term “open” and all of its flavors when applied to science. From Open Access publishing and data sharing efforts, to more transparent ways to conduct bench science and the various “open”s (data, science, access) – the benefits of implementing �...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Review - You are not a gadget

Public Rambling — Fri, 05 Feb 2010 04:07:00 +0100

I just finished reading "You are not a gadget" by Jaron Lanier. The book is very much in the same tone as an article he recently wrote the Edge called "DIGITAL MAOISM: The Hazards of the New Online Collectivism". Very few other books made me want to say "No!" out loud so many times while reading it. I enjoy reading opinions that run contrary to my own because I think it is important to challenge our ideas. This is why I like reading Rough Type. This book, however, was extremely confusing too me. It reads mostly as a collection of essays and often deviates from the path. I still think it was an interesting book to read because of the importance of the topic. If you read the essay linked above you will get the general feeling conveyed in the book. As Lanier writes in the end of t...

Predicting and explaining drug-drug interactions

Public Rambling — Fri, 05 Feb 2010 02:40:00 +0100

I am generally interested in chemogenomic studies and drug interaction studies as a complement to what we work on in the Krogan lab (genetic interactions). Much like in genetic interaction screening, where the fitness of double mutant strains is compared with that of the individual single mutants, chemogenomics tries to identify drug-gene interactions while drug-drug interaction screening attempts to find cases where the combined effect of two compounds on fitness is different from the expected from the combination of the single independent effects. I read two recent papers that I found interesting regarding drug-drug interactions. One was by Bollenbach and colleagues from the Kishony lab (published in Cell) and the other was by Jansen and colleagues (published in MSB). In ...

The new javascript Map/Reduce in Riak

business|bytes|genes|molecules — Thu, 04 Feb 2010 04:09:22 +0100

An Introduction to JavaScript Map/Reduce in Riak from Basho Technologies on Vimeo. Riak is a non-relational datastore with a cool API and nifty Map/Reduce features. The new features in version 0.8 are described here (Source: business|bytes|genes|molecules)

Disagreeing to Disagree

Omics! Omics! — Thu, 04 Feb 2010 00:00:00 +0100

A year ago (almost exactly) I wrote an entry taking to task a paper analyzing protein kinases in the draft chimpanzee genome. After writing that entry, I felt it proper to leave a comment at the journal (BMC Genomics). Instead of publishing the comment, the editor invited me to formalize my criticisms and perhaps give positive suggestions of how to do such an analysis. Between Codon dissolving, my interlude of consulting and starting Infinity this got pushed to late May, it went out for review & a round of revision & then the original authors were invited to write a rebuttal. By the time their rebuttal came back (late fall), I decided I was getting a bit worn on the whole thing and just tweaked my submission to underline a few things rather than go hammer-and-tongs for a counter-rebuttal.A...

LinkedIn+XSLT = FOAF / People from Biohackathon 2010

YOKOFAKUN — Wed, 03 Feb 2010 00:00:00 +0100

I've created a XSLT stylesheet transforming the public HTML pages on LinkedIn about the people going to Biohackathon 2010 to FOAF. The stylesheet worked fine (of course it won't work anymore if LinkedIn change the layout of the HTML pages) and it is available here:http://code.google.com/p/lindenb/source/browse/trunk/src/xsl/linkedin2foaf.xslNote: if possible, the XSLT stylesheet uses geonames.org (Source: YOKOFAKUN)

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Using a FASTA file as a source of RDF statements for SPARQL.

YOKOFAKUN — Wed, 03 Feb 2010 00:00:00 +0100

In this post, I'll show how a Fasta file can be used as a source of RDF statements for the Jena API.The DNA sequences in the Fasta file will be used by Jena without any prior transformation: the file will be used as a Graph by Jena by implementing com.hp.hpl.jena.graph.Graph.Here, my example uses a Fasta file but it could have been any kind of input: a SQL database, a XML file, a GFF file, etc... (Source: YOKOFAKUN)

Searching for Genotypes with SPARQL.

YOKOFAKUN — Mon, 01 Feb 2010 00:00:00 +0100

This week-end, I've noticed that the NCBI has an interface called Genotype Query Form used to query some genotypes the generating the following kind of XML output: (Source: YOKOFAKUN)

ISMB/ECCB 2009 reports

What You're Doing Is Rather Desperate — Sat, 30 Jan 2010 04:22:12 +0100

Great to see more reports describing the use of online tools to cover scientific meetings. Here are the publications, from PLoS Computational Biology: Live Coverage of Scientific Conferences Using Web Technologies. doi:10.1371/journal.pcbi.1000563 Live Coverage of Intelligent Systems for Molecular Biology/European Conference on Computational Biology (ISMB/ECCB) 2009. doi:10.1371/journal.pcbi.1000640 And here’s Ally a.k.a the robo-blogger on Social Networking and Guidelines for Life Science Conferences. Looks like we’ve started a trend, long may it continue at future meetings. Filed under: bioinformatics, meetings, publications Tagged: 2009, eccb, friendfeed, ismb, report (Source: What You're Doing Is Rather Desperate)

PhosphoGRID

What You're Doing Is Rather Desperate — Sat, 30 Jan 2010 04:10:45 +0100

I no longer work on protein kinases but when I did, PhosphoGRID is the kind of database that I would have wanted to see. It features: A nice clean interface, with good use of Javascript Useful information returned from a simple search form Data for download in plain text format with no restrictions or requirements for registration All it lacks is a RESTful API, but nothing is perfect :-) Published in the little-known but often-useful journal Database: PhosphoGRID: a database of experimentally verified in vivo protein phosphorylation sites from the budding yeast Saccharomyces cerevisiae. doi:10.1093/database/bap026. Filed under: bioinformatics, publications, web resources Tagged: database, phosphory, protein kinases (Source: What You're Doing Is Rather Desperate)

PubChem, CouchDB and data pipelines

business|bytes|genes|molecules — Sat, 30 Jan 2010 03:56:30 +0100

Rich Apodaca has a great set of blog posts on using PubCouch, the CouchDB interface for PubChem. The series is great in itself, but I was especially intrigued by the title of the third installment, PubCouch: Streams Aren’t Just for Pipeline Pilot. In the post Rich describes how PubCouch makes it possible to work with the PubChem FTP archive like it was a single large SD file. Recently, I’ve started believing that modern programming paradigm and increasing awareness of RESTful architectures, distributed data processing, messaging etc makes systems like Pipeline Pilot look somewhat dated. They aren’t going to go anywhere soon, but I believe that the power of being able to deliver services to the end user is becoming the norm and developing those services is getting easier ...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Podcasting in Science

business|bytes|genes|molecules — Sat, 30 Jan 2010 03:02:55 +0100

At ScienceOnline 2010 I had the pleasure of organizing a fun an intimate session on podcasting along with Dr. Kiki. The video for the session is now up in six parts. The entire set is embedded below (Source: business|bytes|genes|molecules)

Publishing scientific code

business|bytes|genes|molecules — Fri, 29 Jan 2010 03:22:49 +0100

Software engineers on the team must equally understand that the code is just part of the science, and not usually a goal in its own right. That’s from an article titled Are we taking supercomputing code seriously? by Andrew Jones from the Numerical Algorithms Group Does that mean that code doesn’t have to be published after all? (Source: business|bytes|genes|molecules)

It’s really strange or why the iPad?

Blind.Scientist — Fri, 29 Jan 2010 01:37:34 +0100

It’s really strange to read so many negative stories about the iPad, why it will fail, why it sucks, etc, etc. So many bytes wasted (including these here) to cover something that nobody used yet, no one has ever seen, nor was actually released. So many bytes wasted on stories about something that, if you don’t like and think Apple and Steve Jobs are trying to control their users/customers, you have full control of: like it, buy it, don’t, don’t buy it. So many stories about how closed source computer, software is being forced upon fearful customers. While we worry about that, in the US, companies, corporations are now persons. (Source: Blind.Scientist)

Whither science museums?

Omics! Omics! — Fri, 29 Jan 2010 00:00:00 +0100

Last week at this time I was surviving a terrible electrical storm -- tremendous cracks and crackles all around me. Luckily, it was just the lightning show at the Boston Museum of Science, featuring the world's largest Van de Graaf generator and a pair of huge Tesla coils and other sparking whatnots. TNG was part of a huge overnight group.I love the MoS and always enjoy a trip there. But it isn't hard to go there and wonder what the future of such museums are and how the current management is taking them. Exhibit #1: The big event at the MoS right now is the traveling Harry Potter show. We of course got tickets and lumped on audio tour. It's great fun, especially if you enjoyed the movies (it is mostly movie props & costumes), but makes absolutely no pretensions of having even a veneer of ...

Whiter science museums

Omics! Omics! — Fri, 29 Jan 2010 00:00:00 +0100

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Something is not open at PLoS, maybe …

Blind.Scientist — Thu, 28 Jan 2010 17:44:04 +0100

I really like reading some articles posted on Hacker News. Usually they focus on the entrepreneur side of the software/web business, but sometimes there are some nice pointers to scientific stuff. And most of the comments are also really nice, a lot of clever people around there. But this is what you expect of these virtual communities. Anyway, I’m here to talk about PLoS. Yesterday somebody posted at HN, an article about open access to publications: Open Access to Scientific Publications The good, the bad, and the ugly. It’s a so-so read, but gives some information on the current scenario of open and closed access publishers. But what really caught my eye (thanks initially to a comment on HN) is this passage: But how much are authors ready to pay to publish an article? A few h...

Science and libraries: Letting the crowd talk

business|bytes|genes|molecules — Thu, 28 Jan 2010 16:24:37 +0100

I will write about this more in a later post, but thought it would be interested to throw out the discussion that started when I stated out aloud that librarians need to evolve their role. The genesis comes from the assumption that as experts librarians are required to connect people to information, which to me sounds a lot like the argument that print/traditional media kept making as they failed to evolve. Maybe the analogy is not a viable one, but in the search era, the role must evolve. My thoughts on this are still in the works, so for now, the Friendfeed discussion (Source: business|bytes|genes|molecules)

iPad is excellent!!!

Blind.Scientist — Thu, 28 Jan 2010 15:08:17 +0100

Just sayin’. With all the negative reviews, ponderations, blog posts, newspaper reports, I just wanted to give so kudos to Steve and the Apple family. Is it the best product ever? No. Is it the next coming of Jesus Christ? No. So what is it? It’s just another product, and you, only you (maybe with your wife/husband/partner/household) will decide if it fits your budget, if it is useful for you and if you actually need to buy it. Apart from that, rants are always good for the people that writes them (I know it firsthand). The icing on the cake is when I overheard two homeless guys discussing if you could multitask on an iPad. When they discovered you couldn’t, they decided not to buy it. Last time I saw them they were in the public library computers. (Source: Blind.Scientis...

Microsoft is more detrimental to Science, than the lack of Open Science, …

Blind.Scientist — Thu, 28 Jan 2010 14:56:54 +0100

than the lack of funding, than the publishing companies, than old-fashioned scientists, than PZ Meyers, more than Linux, more than Apple, more than anything I know. Ok, let me explain then. But before that, a disclaimer: I own Windows 95, 98, XP and Vista, and this represents only my opinion, not the opinion of my employers, co-workers and family. And why is MSFT more detrimental to Science than anything else? It’s simple: the openness of their system. Maybe open is not the right word, transparency might better to explain it. As MSFT has the leadership on the OS market, vendors tend to attach their products (in this case laboratory equipments, analysis software, etc) to the OS. And how that is bad? Because when it works, it works fine, but when it doesn’t work, it’s a ni...

From the “blogosphere”? Hardly.

What You're Doing Is Rather Desperate — Thu, 28 Jan 2010 02:40:23 +0100

I generally skip over “From the Blogosphere”, a (mostly) weekly-summary of one or two blog posts in Nature’s “Authors” section (here is the latest). Why? Well, I’ve always suspected that the title is rather misleading. Now, I have the hard numbers to prove it. My feed reader contains an archive of 128 articles, dating back to May 10 2007. I used them to create this CSV file with 3 fields: Date, Blog and Source. The “Blog” field contains the name of the primary blog mentioned in “From the Blogosphere”. On rare occasions where 2 blogs are mentioned, 2 entries were added to the CSV file. I skimmed each article rather quickly, so I may have missed blogs that were mentioned in passing. Next, a short R script: library(ggplot2) # read ...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Feynman and me

Blind.Scientist — Thu, 28 Jan 2010 01:40:01 +0100

I’m reading the second book on Feynman, What Do You Care What Other People Think?: Further Adventures of a Curious Character and the only thing I can he was an incredible person, one that any one can admire. I have no idols, I don’t worship anyone, but Feynman gets the closest possible to being one for me. (Source: Blind.Scientist)

A little more Scala

Omics! Omics! — Thu, 28 Jan 2010 00:00:00 +0100

I can't believe how thrilled I was to get a run-time error today! Because that was the first sign I had gotten past the Scala roadblock I mentioned in my previous post. It would have been nicer for the case to just work, but apparently my SAM file was incomplete or corrupt. But, moments later it ran correctly on a BAM file. For better or worse, I deserve nearly no credit for this step forward -- Mr. Google found me a key code example.The problem I faced is that I have a Java class (from the Picard library for reading alignment data in SAM/BAM format). To get each record, an iterator is provided. But my first few attempts to guess the syntax just didn't work, so it was off to Google.My first working version is package helloimport java.io.Fileimport org.biojava.bio.Annotationimport org.bioja...

Elementary school for Bioinformatics: Suffix Arrays

YOKOFAKUN — Thu, 28 Jan 2010 00:00:00 +0100

I was recently asked to map the flanking ends of a large set of SNPs on the human genome. As a perfect match algorithm was sufficient I've implemented a suffix array algorithm to map each flanking sequence. Via Wikipedia:A suffix array is an array of integers giving the starting positions of suffixes of a string in lexicographical order. It can be used as an index to quickly locate every (Source: YOKOFAKUN)

All-in-one usually does not work

business|bytes|genes|molecules — Wed, 27 Jan 2010 06:42:50 +0100

Weren’t all-in-one services like Launchpad supposed to save us from this insanity? Stuart Sierra poses that question in a blog post where he bemoans the fact that the Clojure community is spread out across a number of places. As a result, being an active member of the community, he needs to pay attention to half a dozen, perhaps more, to keep on top of things. He answers his own question But they never can, because everyone has different tastes when it comes to bug tracking, version control, and mailing lists That is not a phenomenon just for programming languages, but for various other groups, including scientists, who tend to have very different tastes across a number of areas. Which is why I don’t think a single destination site is going to work for research and collaboration. Y...

Clustering GEO samples by title (briefly) revisited

What You're Doing Is Rather Desperate — Wed, 27 Jan 2010 01:29:56 +0100

So, we had a brief discussion regarding my previous post and clearly the statement: The longest key for which values exist classifies your titles does not hold true for all cases. Not that I ever said that it did! I remind you that this blog is a place for the half-formed ideas that spill out of my head, not an instruction manual. Let’s look, for example, at GSE19318. This GEO series comprises 2 platforms: one for dog (10 samples) and one for humans (1 sample), with these sample titles: ['Dog-tumor-81705', 'Dog-tumor-78709', 'Dog-tumor-88012', 'Dog-tumor-8888302', 'Dog-tumor-209439', 'Dog-tumor-212227', 'Dog-tumor-48', 'Dog-tumor-125', 'Dog-tumor-394', 'Dog-tumor-896', 'Human-tumor'] Run that through the Ruby code in my last post and we get: {"Dog-tumor-48"=>["...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

The Scala Experiment

Omics! Omics! — Wed, 27 Jan 2010 00:00:00 +0100

Well, I've taken the plunge -- yet another programming language.I've written before about this. It's also a common question on various professional bioinformatics discussion boards: what programming language.It is a decent time to ponder some sort of shift. I've written a bit of code, but not a lot -- partly because I've been more disciplined about using libraries as much as possible (versus rolling my own) but mostly because coding is a small -- but critical -- slice of my regular workflow. At Codon I had become quite enamored with C#. Especially with the Visual Studio Integrated Development Environment (IDE), I found it very productive and a good fit for my brain & tastes. But, as a bioinformatics language it hasn't found much favor. That means no good libraries out there, so I must buil...

QuoteEditor

YOKOFAKUN — Tue, 26 Jan 2010 00:00:00 +0100

It's 00H25 here, and while one of my programs is aligning some SNPs on the human genome, I'm going to describe the tiny tool I wrote this Week-end. QuoteEditor is a java editor used to store some famous quotes in a RDF/XML file. The java 'jar' and the documentation are available at :http://code.google.com/p/lindenb/wiki/RDFQuotes.Usagejava -jar lindenb/build/quotes.jar [-f ]the (Source: YOKOFAKUN)

Never understood

Blind.Scientist — Mon, 25 Jan 2010 14:38:13 +0100

I never understood why people with good functioning limbs (all four of them) press the button that automatically opens doors in public buildings. I guess they are the ones that have a disabled parking permit and drive a pickup truck. (Source: Blind.Scientist)

“Thinking algorithmically”: clustering GEO samples by title

What You're Doing Is Rather Desperate — Sun, 24 Jan 2010 05:03:00 +0100

Today’s challenge. Take a look at this array, which contains the “title” field for the 6 samples from GSE1323, a series in the GEO microarray database: ['SW-480-1','SW-480-2','SW-480-3','SW-620-1','SW-620-2','SW-620-3'] Humans are very good at classification. Almost instantly, you’ll see that there are 2 classes, “SW-480″ and “SW-620″, each with 3 samples. How can we write a program to do the same job? I’m sure that for those with formal training in computer science and algorithms, this is pretty trivial. The rest of us have to figure it out from first principles. Here’s what I did, in words: # Imagine that you have 2 titles: "abc1" and "abc2" # Take the first character - call it the key, call the remaining...

Books 2010

Blind.Scientist — Sat, 23 Jan 2010 14:54:54 +0100

1 – The New New Thing: A Silicon Valley Story 2 – What Do You Care What Other People Think?: Further Adventures of a Curious Character (Source: Blind.Scientist)

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Thanks Conan!

Blind.Scientist — Sat, 23 Jan 2010 13:47:10 +0100

Seven months of fun, barely missed one episode. (Source: Blind.Scientist)

Hosting Applets in Google Docs

eric.jain.name — Fri, 22 Jan 2010 23:44:46 +0100

Google Docs recently added support for uploading arbitrary files (up to 250MB large). Can this be used to host Java applets? I uploaded a jar file containing a simple test applet to Google Docs and referenced it like so: <applet width="440" height="60" code="JavaVersionDisplayApplet.class" codebase="http://docs.google.com/" archive="uc?id=0B9ANnqvnRtroOTM5YWE3YmMtMGZkMy00ZGE5LWE2NWUtOGZhNzk5MzA2NzBk"> </applet> The result: (Source: eric.jain.name)

Recently read - Jan 2010

Public Rambling — Fri, 22 Jan 2010 22:13:00 +0100

In this study HeLa cells were synchronized in different stages of the cell cycle and their proteins and phosphorylation sites were quantified relative to asynchronous cells using a SILAC mass-spec approach. Changes in protein abundance and phosphorylation were combined with transcriptional changes and these were used to identify previously known and potentially novel complexes and kinase-substrate interactions important for cell-cycle progression. In addition, I thought it was pretty cool that the authors found a way to directly quantify the phosphorylation site occupancy from the mass-spec results. I was only slightly disappointed that the authors did not attempt to do a cross-species analysis given the available data from Liam Holt et al. on Cdk1 phosphorylation in S. cerevisiae. (Bonus-...

Stay away

Blind.Scientist — Fri, 22 Jan 2010 19:22:10 +0100

from Toronto’s (GTA’s) streets for sometime. Twelve people died crossing the streets this year in the region. Stay away. (Source: Blind.Scientist)

The Great Australian Internet Blackout Wordpress Plugin

Your bones got a little machine. — Fri, 22 Jan 2010 00:28:49 +0100

Normally I stick to posts about science and technology on this blog. Like most Australians, I vote in elections, try to remain informed, but otherwise stay away from getting involved in politics. However, occasionally certain things become important enough issues that they need to be advertised more widely. As you may know, the Australian Federal Government is attempting to censor the Internet within Australia by forcing ISPs to block a list of websites. This proposed internet filter will not be optional; it will effect all Australians, and the blocklist will compiled by a small group of people. The list of blocked sites will remain secret, so the Australian public will find it difficult to determine if this power is being abused. It will not prevent the spread of illegal material, which i...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Science Online 2010 – Where are the geeks?

business|bytes|genes|molecules — Thu, 21 Jan 2010 05:05:03 +0100

My obvious biases are going to come out in this post, but it needs to be written. Bora and Anton organize this great conference every January that allows many people to get together to discuss science on the web. As always, I quite enjoyed the event, mostly cause of the social interactions, and some excellent sessions. This year I got to finally meet in person Pawel Szczesny, Steve Koch, Dr. Kiki, and Michael Habib (I am sure I’ve missed someone). Jonathan Eisen has a great post (and this funny one) about the event. Having said that, I find something troubling. There are far too many sessions on journalism and policy, and far too little on doing science and even less on the “developer” side of things. So consider this post a call to action. Next year, we should get better...

Premium

Blind.Scientist — Thu, 21 Jan 2010 01:32:52 +0100

Brazilian president is receiving a prize for global leadership in Davos. If you are not Brazilian, leave a comment if you know what his/her name is. Don’t google it or check Wikipedia. Replies on Twitter (@nuin) or Friendfeed are also valid. (Source: Blind.Scientist)

A plethora of MRSA sequences

Omics! Omics! — Thu, 21 Jan 2010 00:00:00 +0100

The Sanger Institute's paper in Science describing the sequencing of multiple MRSA (methicillin-resistant Staphylococcus aureus) genomes is very nifty and demonstrates a whole new potential market for next-generation sequencing: the tracking of infections in support of better control measures.MRSA is a serious health issue; a friend of mine's relative is battling it right now. MRSA is commonly acquired in health care facilities. Further spread can be combated by rigorous attention to disinfection and sanitation measures. A key question is when MRSA shows up, where did it come from? How does it spread across a hospital, a city, a country or the world?The gist of the methodology is to grow isolates overnight in the appropriate medium and extract the DNA. Each isolate is then converted into a...

I'm definitely not volunteering for sample collection on this project

Omics! Omics! — Wed, 20 Jan 2010 00:00:00 +0100

My post yesterday was successful at narrowing down the identity of the mystery creature to a spider of the genus Araneus. Another victory for crowd sourcing! It also points out the value of questioning your assumptions & conclusions. My initial thought on looking at the photos was that the body plan looked spider-like and details of the head and abdomen sometimes pointed me that way -- but then the lack of eight legs convinced me it must be an insect (I thought I could count six in some photos).One of the commenters addressed my mystery vine with a suggestion that underscored a key detail I inadvertantly left out. The vine raised welts on my legs when it grabbed me -- not in some exaggerated sense, but it definitely had some sort of fine projections (trichomes?) which were not what I'd cal...

Why I won’t watch Avatar (or at least pay for)

Blind.Scientist — Tue, 19 Jan 2010 17:51:05 +0100

That works for me, maybe not for you. And that is where the mask of Canadian-style humility and niceness came off James Cameron, the engineer’s son from Kapuskasing, and the scarily arrogant, tactless King of the World (as he called himself at the 1998 Oscar show) slipped out. (Source: Blind.Scientist)

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Green Krittah

Omics! Omics! — Tue, 19 Jan 2010 00:00:00 +0100

As a youth, I was fortunate enough to spend four summers working as a camp counselor. Three of those were spent in the Nature Department, performing all sorts of environmental education functions (one year I taught archery). One of my enjoyable duties was to wander the wilds of the camp looking for interesting living organisms to put in our terraria and aquaria, a job I relished -- though the campers could often top me for interesting (I never could find a stick insect, but we rarely lacked for one). During one of those forays, most likely in my favorite sport of hand-catching of frogs, I stumbled onto a patch of a plant I did not recognize. I still remember it rather well -- perhaps because of the small itchy welts it raised on my unprotected legs. No, not nettles (we had plenty of those,...

What I learned this week about: productivity, MongoDB and nginx

What You're Doing Is Rather Desperate — Fri, 15 Jan 2010 08:45:46 +0100

Productivity It was an excellent week. It was also a week in which I payed much less attention than usual to Twitter and FriendFeed. Something to think about… MongoDB I’m now using MongoDB so frequently that I’d like the database server to start up on boot and stay running. There are 2 init scripts for Debian/Ubuntu in this Google Groups thread. I followed the instructions in the second post, with minor modifications to the script: # I like to keep mongodb in /opt PATH=/usr/local/sbin:/usr/local/bin:/sbin:/bin:/usr/sbin:/usr/bin:/opt/mongodb/bin DAEMON=/opt/mongodb/bin/mongod # you don't need 'run' in these options DAEMON_OPTS='--dbpath /data/db' # I prefer lower-case name for the PID file NAME=mongodb # I think /data/db should be owned by the mongodb user sudo chown -R ...

I’m with Coco

Blind.Scientist — Thu, 14 Jan 2010 23:45:28 +0100

(Source: Blind.Scientist)

The joys of print

Public Rambling — Thu, 14 Jan 2010 22:14:00 +0100

For the past two months I have been enjoying my first ever print subscription to a scientific journal. The good folks over at Nature Reviews Genetics offered my a small discount that nudged me to it (thank you!). I thought that if I ever tried a print subscription it would be for sure a review journal. I can't say I regret the decision. Having the print issue to read on my commute makes me read articles that I would not normally print out and the front section (research highlights) is a good way to catch up to science news. Maybe this explosion of e-readers will make it easier to emulate the browsing experience of a bound print copy. As Nicholas Carr (and others) have pointed out, changes in internet technology shape the way we think and use information. In a recent post, Carr giv...

A new twist on the identifier mapping problem

What You're Doing Is Rather Desperate — Tue, 12 Jan 2010 03:57:02 +0100

Yesterday, Deepak wrote about BridgeDB, a software package to deal with the “identifier mapping problem”. Put simply, biologists can name a biological entity in any way that they like, leading to multiple names for the same object. Easily solved, you might think, by choosing one identifier and sticking to it, but that’s apparently way too much of a challenge. However, there are times when this situation is forced upon us. Consider this code snippet, which uses the Bioconductor package GEOquery via the RSRuby library to retrieve a sample from the GEO database: require "rubygems" require "rsruby" if ENV['R_HOME'].nil? ENV['R_HOME'] = "/usr/lib/R" end r = RSRuby.instance r.library("GEOquery") sample = r.getGEO("GSM434143"...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Video: Building a data intensive application with Hadoop and Hive

business|bytes|genes|molecules — Tue, 12 Jan 2010 02:52:56 +0100

I have written about TrendingTopics before. Pete Skomoroch gave a talk on how to build a data intensive web app using Hadoop, Hive and Amazon EC2 at Hadoopworld and the video is now available Building Data Intensive Apps with Hadoop and EC2 from Cloudera on Vimeo. Please see this disclaimer (Source: business|bytes|genes|molecules)

The Array Killers?

Omics! Omics! — Tue, 12 Jan 2010 00:00:00 +0100

Illumina announced their new HiSeq 2000 instrument today. There are some great summaries at Genetic Future and PolitGenomics; read both for the whole scoop. Perhaps just as jaw dropping as some of the operating statistics on the new beast is the fact that Beijing Genome Institute has already ordered 128 of them. Yow! That's (back-of-envelope) around $100M in instruments which will consume >$30M/year in reagents. I wish I had that budget!Illumina's own website touts not only the cost (reagents only) of $10K per human genome, but also that this works out to 200 gene expression profiles per run at $200/profile. That implies multiplexing, as there are 32 lanes on the machine (16 lanes x 2 flow cells -- or is it 32 lanes per flowcell? I'm still trying to figure this out based on the note that i...

In science, data without purpose is sometimes required

Public Rambling — Mon, 11 Jan 2010 03:00:00 +0100

The title is probably flamebait but it might get you to read my little rant about data production in science. Its something I have been meaning to write about for a while but Deepak's post provided the extra incentive. I think Deepak's post was a reminder that science is nothing without hypothesis and I certainly agree with that. To put this into context maybe it worth pointing again to the wired article about "The End of Theory" where Chris Anderson painfully tries to make the point that with the deluge of data that we are seeing we don't need models or hypothesis we just need to crunch the data to look for correlations. I strongly disagree with this viewpoint. What would we learn about reality this way ? At most we would see correlations and could have some predictive power about fut...

BridgeDB: Middleware for ID mapping

business|bytes|genes|molecules — Mon, 11 Jan 2010 02:19:09 +0100

Many complementary solutions are available for the identifier mapping problem. This creates an opportunity for bioinformatics tool developers. Tools can be made to flexibly support multiple mapping services or mapping services could be combined to get broader coverage. This approach requires an interface layer between tools and mapping services. This is the background behind a paper on BridgeDB by Iersel, et al. BridgeDB is an ID mapping framework that provides a standardized interface which can be used to connect bioinformatics tools to different identifier mapping services. Without pushing it myself, I can only comment on intent, and this is exactly the kind of idea that some of us have been encouraging bioinformatics types to develop and use. One of the most important aspects of buildi...

Memories

Blind.Scientist — Sun, 10 Jan 2010 17:50:34 +0100

Image via Wikipedia (I’m really behind on my promise to post 365 in 365, four to keep the average on 1, three to go after this one) In mid-October I went to Brazil, first to attend the 2009 X-Meeting in Angra dos Reis and for a first vacation period since 2005. When I moved to Canada, I wasn’t able to bring all the scientific literature I had amassed over the years, mostly stuff about frogs, evolution and phylogenetics. Nowadays printed or copied papers and out-of-date, PDF is the new in, so I decided to throw away most of the things I would be able to recover online later, but still keep some copies of rare stuff and original copies of papers. Some of the original copies I saved where from the 50’s, 60’s and 70’s, and some of these contained the stamp tha...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Movies 2010

Blind.Scientist — Sun, 10 Jan 2010 15:43:48 +0100

The Box – 5/5 (Source: Blind.Scientist)

Books 2010

Blind.Scientist — Sun, 10 Jan 2010 15:42:59 +0100

1 – The New New Thing: A Silicon Valley Story (Source: Blind.Scientist)

What is the CSS style of that HTML element ?: CSSPopup, an extension for firefox

YOKOFAKUN — Sun, 10 Jan 2010 00:00:00 +0100

Trying to find the CSS style of a HTML element is a common task for me and I often look in the of the pages to try to find what can be "this inspiring CSS". So, I've created CSSPopup, a small extension for firefox. This extension appends a new button in the contextual menu that will print all the CSS selectors of the element that was clicked. For example when I clicked on "Welcome to (Source: YOKOFAKUN)

There's Plenty of Room at the Bottom

Omics! Omics! — Sun, 10 Jan 2010 00:00:00 +0100

Friday's Wall Street Journal had a piece in the back opinion section (which has items about culture & religion and similar stuff) discussing Richard Feynman's famous 1959 talk "There's Plenty of Room at the Bottom". This talk is frequently cited as a seminal moment -- perhaps the first proposition -- of nanotechnology. But, it turns out that when surveyed many practitioners in the field claim not to have been influenced by it and often to have never read it. The article pretty much concludes that Feynman's role in the field is mostly promoted by those who promote the field and extreme visions of it.Now, by coincidence I'm in the middle of a Feynman kick. I first encountered him in the summer of 1985 when his "as told to" book "Surely You're Joking Mr. Feynman" was my hammock reading. The n...

To handle lots of data, we need to think differently

business|bytes|genes|molecules — Sat, 09 Jan 2010 17:09:35 +0100

In a recent editorial (sub might be required) talking about next-gen sequencing and cloud computing, Nature Biotech makes an all to familiar error. It remains unclear, however, whether the cost of routinely renting time on the cloud would be cost effective in the long term, particularly if a user intends to analyze billions of base pairs of genome sequence on a regular basis. What’s more, if the wide uptake of sequence analysis on clouds depends on the availability of user-friendly, debugged software, bioinformaticians might not be willing to spend the time to familiarize themselves with hadoop, the open source program needed to process large data sets on a cloud—especially when their jobs focus on developing algorithms for their own local computer clusters. The context for that...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

In science, data is nothing without purpose

business|bytes|genes|molecules — Sat, 09 Jan 2010 04:16:39 +0100

In an article on TechFlash, a VC, talking about trends in 2010, had this to say while talking about increased IT needs in cleantech and biotech Both areas are generating terabytes of data and it is no longer just about science — it is about digesting mountains of data. For some reason that statement scared me. Digesting mountains of data is all about the science. If we forget that, we are in big trouble. Yes, from a pure technology perspective it is about digesting mountains of data, but (a) that has to be looked at in the context of science (sense-making?), and (b) the digesting is a necessary pre-requisite to getting to the science. You really don’t have much of a choice, but if you forget about the science, you will end up with noise, a whole lot of it. My advice to all ...

Samples per series/dataset in the NCBI GEO database

What You're Doing Is Rather Desperate — Fri, 08 Jan 2010 01:01:09 +0100

Andrew asks: I want to get an NCBI GEO report showing the number of samples per series or data set. Short of downloading all of GEO, anyone know how to do this? Is there a table of just metadata hidden somewhere? At work, we joke that GEO is the only database where data goes in, but it won’t come out. However, there is an alternative: the GEOmetadb package, available from Bioconductor. The R code first, then some explanation: # install GEOmetadb source("http://bioconductor.org/biocLite.R") biocLite("GEOmetadb") library(GEOmetadb) # connect to database getSQLiteFile() con <- dbConnect(SQLite(), "GEOmetadb.sqlite") # count samples per GDS gds.count <- dbGetQuery(con, "select gds,sample_count from gds") gds.count[1:5,] # first 5 results...

How to: archive data via an API using Ruby and MongoDB

What You're Doing Is Rather Desperate — Thu, 07 Jan 2010 00:17:46 +0100

I was going to title this post “How to: archive a FriendFeed feed in MongoDB”. The example code does just that but (a) I fear that this blog suggests a near-obsession with FriendFeed (see tag cloud, right sidebar) and (b) the principles apply to any API that returns JSON. There are rare examples of biological data with JSON output in the wild, e.g. the ArrayExpress Gene Expression Atlas. So I’m still writing a bioinformatics blog ;-) Let’s go straight to the code: #!/usr/bin/ruby require "rubygems" require "mongo" require "json/pure" require "open-uri" # db config db = Mongo::Connection.new.db('friendfeed') col = db.collection('lifesci') # fetch json 0.step(9900, 100) {|n| f = open("http://friendfeed-api.com/v2/feed/...

Transforming Pubmed to Simile/Exhibit with XSLT

YOKOFAKUN — Wed, 06 Jan 2010 00:00:00 +0100

Cameron Neylon recently asked on friendfeed:"Advice request: What is the best approach to exposing a publications list online. Any good tools for generating html/xml/rdfa?".In the comments, it was suggested to use Simile/Exhibit. This gave me the idea to write a XSLT stylesheet to transform a pubmed xml result to an Exhibit file. This XSLT stylesheet is available at:http://code.google.com/p/ (Source: YOKOFAKUN)

On Being a Scientific Zebra

Omics! Omics! — Wed, 06 Jan 2010 00:00:00 +0100

I got a phone call today from someone asking permission to suggest me as a reviewer of a manuscript this person was about to submit. For future reference, if it's similar to anything I've blogged about, I'd be happy to be a referee. I generally get my reviews in on time (though near deadline), a practice I have gotten much better about since getting a "your review is late" note from a Nobelist -- not the sort of person you want to get on the wrong side of.I end up reviewing a half dozen or so papers a year, from a handful of journals. NAR has used me a few times & I have some former colleagues who are editors are a few of the PLoS journals. There's also one journal of which I'm on the Editorial Board, Briefings in Bioinformatics (anyone who wishes to write a review is welcome to leave cont...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

A Decade in Computational Structural Biology

Trapped in the USA — Tue, 05 Jan 2010 08:53:30 +0100

I shake my head and suddenly realize a decade has almost passed since I first became a computational structural biologist. Feeling that I’ve earnt some kind of perspective, I hereby present to you my list of highlights in computational structural biology of the naughties: 1. Rosetta. There is no doubt in my mind that the greatest contribution to computational structural biology this decade is the suite of programs known as Rosetta, written by David Baker and his lab. Look at the accomplishments. Rosetta has consistently won CASP (see next item) in the new fold category. Nothing else comes close in deducing the structure of a protein from an arbitrary protein sequence. Rosetta was used to create a protein with the first artificial fold. Rosetta was also used to design the first ar...

Phrase of the day

Blind.Scientist — Tue, 05 Jan 2010 00:33:23 +0100

Post of the day is the phrase of the day, overheard online in an interview on the Brazilian TV channel, Globo News: “(…) Brazil’s urban planning is prehistorical (…)”. I can say that not only urban planning is prehistorical. (Source: Blind.Scientist)

My Python notebook: displaying the state of the Genome Projects

YOKOFAKUN — Tue, 05 Jan 2010 00:00:00 +0100

This post if about my first Python program. I'm still a newbie so please, don't flame ! :-)The NCBI hosts a XML file describing the state of the Genome Projects at ftp://ftp.ncbi.nih.gov/genomes/genomeprj/gp.xml. The very first lines of the file look like this: (Source: YOKOFAKUN)

HPC over the past decade

business|bytes|genes|molecules — Mon, 04 Jan 2010 15:42:00 +0100

Joe Landman has a series of posts providing a great perspective on HPC over the past decade. I suggest anyone interested in computing read them Part 1 Part 2 Part 3 – This one is a must read Part 4 Part 5 – Another great read and a subject that I used to blog about a lot (mostly channeling Joe) Part 6 – Close to home Part 7 – Storage technology, something I care about more and more (Source: business|bytes|genes|molecules)

Stitching different web tools to organize a project

Public Rambling — Sun, 03 Jan 2010 18:12:00 +0100

A little over a year ago I mentioned a project I was working on about prediction and evolution of E3 ligase targets (aka P1). As I said back then, I am free to risk as much as I want in sharing ongoing results and Nir London just asked me how the project is going via the comments of that blog post so I decided to give a bit of an update. Essentially, the project quickly deviated from course since I realized that predicting E3 specificity and experimentally determining ubiquitylation sites in fungal species (without having to resort to strain manipulation) were not going to be an easy tasks. So, since the goal was to use these data to study the co-evolution of phosphorylation switches (phosphorylation regulating ubiquitylation) it makes little sense to restrain the analysis speci...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

APIs are powerful platforms

business|bytes|genes|molecules — Sun, 03 Jan 2010 04:32:11 +0100

APIs; an area that we life science folks are not very good at. I once heard Mark Shuttleworth talk about building stuff that people can use to build more stuff (paraphrasing heavily). In other words we need to think about application and data platforms and for modern bioinformatics that is pretty much what we should strive to be doing. If one looks at the type of programming that needs to be done in the life sciences, you have applications that solve specific problems; alignments, assembly, etc, and ideally these should be applications that can be brought together without the developer having to worry about data formats, or at least handle those with minimal fuss. There are those who specialize in information retrieval, digging deep into data, slicing and dicing data sets. In a perfect wor...

Lies, lies and even more lies

Blind.Scientist — Sun, 03 Jan 2010 02:59:28 +0100

At the time of the Copenhagen meeting about climate change, Brazilian representatives were major protagonists, specially when criticizing all developed countries about their carbon emissions. The crook, also known as the Brazilian president, kept reminding everyone how advance Brazil is on “green” policies, how much native forests are still there, and saying the the developed countries have to do something to erase their polluted heritage. Well, I don’t think many of my 3 readers (yes, I got an extra one this last week!) have ever been to Brazil, so I would like to list some of the lies about Brazilian “green” policies and actions: - São Paulo is the largest city of the Southern Hemisphere, and there’s no effective recycling service. Now, imagine, 10+ ...

2009 – the posts that never made it

Your bones got a little machine. — Sat, 02 Jan 2010 11:57:23 +0100

So, people tell me 2009 ended recently. Apparently there were fireworks and stuff. This blog as seen very little action during 2009, despite my various good intentions for a blog ‘reboot’ (ala Pawel). Like many of my online friends, I blame FriendFeed. I find commenting on a FriendFeed post a much more productive way of having a conversation around some new development sweeping the web than writing a dedicated blog post. Still, despite this being my “year of FriendFeed”, I started writing a few blog posts / articles / essays this year which never made it out of the Drafts folder. There is a positive side to unpublished drafts – they serve to nicely organize some thoughts, even if they are ultimately never shared. Anyhow, it’s time to clean them out and m...

365 in 365

Blind.Scientist — Fri, 01 Jan 2010 15:37:04 +0100

I plan to post 365 entries either here, here or here in 2010. I might not post everyday, but I will try to keep the mark, even if it’s only a one-liner or some link to interesting news/software/paper. Happy New Year everyone! (Source: Blind.Scientist)

Yet another year is in the can

business|bytes|genes|molecules — Fri, 01 Jan 2010 00:35:33 +0100

It is now four years to the day that this incarnation of bbgm was born. And it’s come a long way since then as have I. No longer do I feel the need to push out a blog post or more per day and it’s only partly due to a lack of time. The way I look at it, there is a time in the life of a blog where writing often is almost necessary if you want to build an audience, but you ultimately reach a place where unless blogging is your core output, there are other avenues (Twitter, Posterous, FriendFeed, etc) that are more appropriate for certain forms of discussion. Over those years, I’ve covered a number of topics and been involved in many communities, and it’s rather pleasing to see all the new blogs and new names in the online world that so many of us live in. I am more pa...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Best of the decade

Blind.Scientist — Thu, 31 Dec 2009 03:37:38 +0100

Friends, as the year draws to a close, I felt compelled to compile the best of the decade of 00s. The list is: will be posted here as soon as the decade ends on Dec 31st, 2010. (Source: Blind.Scientist)

More musings on MapReduce and bioinformatics

business|bytes|genes|molecules — Tue, 29 Dec 2009 06:15:08 +0100

Jeff Dean and Sanjay Ghemawat have an updated MapReduce paper (doi) in the Communications of the ACM. The paper is a pretty strong rebuttal to some claims by Mike Stonebraker and others on the value of the MapReduce model. I am going to let you read the paper (as well as the original papers). What I wanted to talk about were some of the key aspects of the MapReduce model and how this way of thinking is relevant to the life sciences. The first point that Dean and Ghemawat talk about is heterogenous systems. The way I see it, the entire field of bioinformatics is full of heterogenous systems. Even data we generate in internal systems needs to be combined with data from other systems. In fact, I am pretty sure that as we improve delivery models and APIs for life science data resources, we wil...

Length matters!

Omics! Omics! — Mon, 28 Dec 2009 00:00:00 +0100

I was looking through part of my collection of papers using Illumina sequencing and discovered an unpleasant surprise: more than one does not seem to state the read length used in the experiment. While to some this may seem trivial, I had a couple of interests. First, it's useful for estimating what can be done with the technology, and second since read lengths have been increasing it is an interesting guesstimate of when an experiment was done. Of course, there are lots of reasons to carefully pick read length -- the shorter the length, the sooner the instrument can be turned over to another experiment. Indeed, a recent paper estimates that for RNA-Seq IF you know all the transcript isoforms then 20-25 nucleotides is quite sufficient and you are interested in measuring transcript levels (...

Loosely coupled tools: BWA

business|bytes|genes|molecules — Thu, 24 Dec 2009 08:12:12 +0100

I am hardly a practitioner anymore, so take the following with that caveat firmly in your mind. I first heard about the Burrows-Wheeler transform from slides presented by Mike Schatz. That particular method underlies BWA, which from the looks of it is one top notch aligner. What I found interesting about BWA was not the quality or breadth of alignment capabilities, but that it did one thing well. The other day I wrote about loosely coupled tools. It’s not always ideal to have a tool that does one thing well, but in many cases it makes a lot of sense. In this particular case, being able to combing BWA with an existing set of tools (SAMTools) does not take away any power, but makes the core functionality more effective, or so it seems. I wonder how the world of APIs and loosely coupled...

Developing effective bioinformatics programming skills

business|bytes|genes|molecules — Thu, 24 Dec 2009 07:32:04 +0100

Back on Coast to Coast Bio #13 we talked about Joel Dudley’s seminar on programming effectively for bioinformatics (slides). Joel has converted that into a article in PLoS Computational Biology. For many Biogangers, the article might be obvious, but for many getting their start, or getting into the programming side of things, this paper is a great read. It also is very contemporary and talks about a lot of current best practices. Some of the key areas which are often forgotten by scientific programmers Documenting and managing projects Maintaining source code Parallel computing, including shoutouts to the kinds of distributed computing paradigms that I find particularly interesting Structured data If you are expecting a deep dive into each topic this is not the article you are look...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

The Life Scientists at FriendFeed: 2009 summary

What You're Doing Is Rather Desperate — Wed, 23 Dec 2009 08:15:40 +0100

The Life Scientists 2009 It’s Christmas Eve tomorrow and so I declare the year over. My Christmas gift to you is a summary of activity in 2009 at the FriendFeed Life Scientists group. It’s crafted using R + Ruby, with raw data and some code snippets available. If you want to see the most popular items from the group this year, head down to the bottom of this post. (Note: this post is a work in progress) The contributors First of all, take a look at yourselves. There are, allegedly, 1250 subscribers to the group, but I can only retrieve profiles for 1053 of them. 248 of you are rather shy, opting for the default avatar and one or two of you look rather like porn stars. If nothing else, this illustrates the difficulty of compiling reliable user statistics. Here’s how this ...

Loosely coupled tools

business|bytes|genes|molecules — Tue, 22 Dec 2009 07:29:18 +0100

Joshua Shachter has a pretty interesting blog post about blogging tools, one that makes a lot of sense and appeals to a bunch of instincts. In the post, Joshua talks about the separate pieces that make up a blogging system and how they can be served up. In other words, you don’t have to create one complete piece of software, but use existing components to create a blog authoring and serving package. He writes I wonder if there is a way to define loose interfaces between these systems so that they could both work together but also not set APIs in concrete solid enough to stop innovation. Because the various pieces of the systems currently are all tightly bound together, it is very hard for the parts to move forward separately. For example, I’ve wanted to be able to specifically ...

You're Just Not that into Science

Trapped in the USA — Tue, 22 Dec 2009 05:08:11 +0100

It’s sad to say this but most people I work with are just not that into science. It’s not that they’re not good at it – they clearly are – it’s just that they’re interested only in their little niche, and are thoroughly satisfied with all that it entails. Case in point: recently, I was at work looking up a biology textbook on basic paleontology, spurred on by the intriguing hypothesis that the Cambrian explosion was induced by the evolution of eyes. My buddy S wanders by and notices that I am reading a first-year biology textbook. Being a curious guy, he asks me why. That’s when, whilst explaining to S the whole theory about eyes and the Cambrian explosion, we were interreputed by a third guy J, who burst out with “Ha ha, that’s...

2009 in review

Blind.Scientist — Sun, 20 Dec 2009 00:55:53 +0100

Here’s the best and worst of 2009: - Movie: Rockrolla, not the best one, but highly entertaining, worst: Funny People - Book: Born Standing Up: A Comic’s Life by Steve Martin, highly entertaining too - Website: The Secret Diary of Steve Jobs, worst: of the ones I usually read is the Daring Fireball - Software: Textmate, worst Mendeley, by 1000 miles - TV: Stephen Colbert and Jon Stewart, the best hour of TV, worst: Dexter’s finale - Purchase: MacBook 13”, the best computer I ever had - Money-grabbing-scheme: Global Warming or Climate Change - Politician: no best in the category, but the worst is the Brazilian President. - Music: I didn’t have a favourite this year. but Matthew Good’s Vancouver is growing on me. No worst, or too many to care about - Best ...

Nano Anglerfish or Feejee Mermaids?

Omics! Omics! — Fri, 18 Dec 2009 00:00:00 +0100

A few months ago I blogged enthusiastically about a paper in Science describing an approach to deorphan enzymes in parallel. Two anonymous commenters were quite derisive, claiming the chemistry for generating labeled metabolites in the paper impossible. Now Science's editor Bruce Alberts has published an expression of concern, which cites worries over the chemistry as well as the failure of the authors to post promised supporting data to their website and changing stories as to how the work was done.The missing supporting data hits a raw nerve. I've been frustrated on more than one occasion whilst reviewing a paper that I couldn't access their supplementary data, and have certainly encountered this as a reader as well. I've sometimes meekly protested as a reviewer; in the future I resolve ...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Name that lab ...

Public Rambling — Thu, 17 Dec 2009 17:24:00 +0100

In the last editorial in Nature, the need for an author ID is introduced with the simple notion that each one of us has specific sets of skills: In his classic book Management Teams, UK psychologist Meredith Belbin used extensive empirical evidence to argue that effective teams require members who can cover nine key roles. These roles range from the creative 'plants' who generate novel ideas, to the disciplined 'implementers' who turn plans into action and the big-picture 'coordinators' who keep everyone working together.From this perspective the author ID is a tool that might help us get appropriate credit for skill sets that are currently undervalued. This sort of argument reminds me of a discussion I had several times in the past about the management structure of academic labs. Why...

Intelligence in Chaos

business|bytes|genes|molecules — Thu, 17 Dec 2009 07:51:18 +0100

Greg Linden has a great article in Communications of the ACM on The Rise of the External Brain. As Greg notes, we have spent a lot of time trying to develop an Artificial Intelligence, a task at which we have not been successful. But he notes that we have had some success from in the form of chaos from the internet. The web, especially search engines supplement our own brain, filling in incomplete bits of knowledge when required. This viewpoint is in direct contradiction to the kinds expressed by Nick Carr, who believes that search engines are not a positive influences on our intelligence. I find myself aligning with Greg. He writes And so it is fitting that the biggest progress on building an external brain also comes from chaos. Search engines pick out the gems in a democratic sea of c...

Playing with Erlang (3): concurrency

YOKOFAKUN — Thu, 17 Dec 2009 00:00:00 +0100

In this post I'll show how to write a multithreaded erlang program where each child process will calculate if a given number is a Prime Number (not rocket science, a brute force algorithm will be used).First this erlang module is called 'prime':-module(prime).The method named 'test' with no argument is public -export([test/0]).The method named 'start' creates a new thread for the function 'loop'. (Source: YOKOFAKUN)

A Doublet of Solid Tumor Genomes

Omics! Omics! — Thu, 17 Dec 2009 00:00:00 +0100

Nature this week published two papers describing the complete sequencing of a cancer cell line (small cell lung cancer (SCLC) NCI-H209 and melanoma COLO-829) each along with a "normal" cell line from the same individual. I'll confess a certain degree of disappointment at first as these papers are not rich in the information of greatest interest to me, but they have grown on me. Plus, it's rather churlish to complain when I have nothing comparable to offer myself.Both papers have a good deal of similar structure, perhaps because their author lists share a lot of overlap, including the same first author. However, technically they are quite different. The melanoma sequencing used the Illumina GAII, generating 2x75 paired end reads supplemented with 50x2 paired end reads from 3-4Kb inserts, wh...

Funding biological data resources revisited

business|bytes|genes|molecules — Tue, 15 Dec 2009 05:48:09 +0100

It is time for a whole new approach. Front-line biology cannot function without these resources, so solutions must be found at both national and international levels. That’s from an editorial in Nature talking about the need to change the way data resources are funded, a topic I have visited before. In this particular case, the resource under question is The Arabidopsis Information Resource (TAIR), which had been funded by the NSF for a decade but is seeing that sole source of funding phased out. As the editorial points out, such challenges are not unique to TAIR, but a problem facing biological databases and repositories, i.e. part of the core infrastructure for the life sciences. I say that because to sustain any data resource you need to sustain infrastructure as well as the devel...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

"The Sound and the Fury": Incomprehensible Gothic

Trapped in the USA — Mon, 14 Dec 2009 02:46:18 +0100

William Faulkner’s “The Sound and the Fury” is one of most reader-unfriendly book I’ve ever read. Written in 1929, it’s clear that Faulkner was enamoured with the new innovations in prose flowing out of Europe such as that diarrhea of words known as stream of consciousness. But there’s good stream of consciousnessness and there’s bad stream of consciousness. Good stream of consciousness conjures up a heightened state of mind. By writing from the inner psyche of the protaganist, we get a better sense of the character through free associations and displacements of languge. Still, stream of consciousness should flow, ratcheting tension through a logic of comprehensible symbolism. Bad stream of consciousness grates on the nerves like an open-mike ...

Parsing a genetic code using flex and bison. Part 1/2

YOKOFAKUN — Mon, 14 Dec 2009 00:00:00 +0100

In this post I'll show how to write a lexer and a parser using Flex and Bison for parsing the genetic codes at NCBI. I'll write a non-reentrant parser that is to say that the generated code contains some global variables and cannot be safely executed concurrently. The input file is an ASN1 file that looks like this:--*************************************************************************-- (Source: YOKOFAKUN)

Parsing a genetic code using flex and bison. Part 2/2

YOKOFAKUN — Mon, 14 Dec 2009 00:00:00 +0100

(this post was inspired from this tutorial: "Writing a Reentrant Parser with Flex and Bison").In the previous post I've shown how to parse a NCBI genetic code in ASN.1 using flex and bison. However the generated code is non reentrant that is to say that some globals variables prevent it to be used in a concurrent environment.If we want to use this code in a multithread environment, some changes (Source: YOKOFAKUN)

Panda Genome Published!

Omics! Omics! — Mon, 14 Dec 2009 00:00:00 +0100

Today's big genomics news is the advance publication in Nature of the giant panda (aka panda bear) genome sequence. For I'll be fighting someone (TNG) for my copy of Nature!Pandas are the first bear (and alas, there is already someone making the mistaken claim otherwise in the Nature online comments) and only second member of Carnivora (after dog) with a draft sequence. Little in the genome sequence suggests that they have abandoned meat for a nearly all-plant diet, other than an apparent knockout of the taste receptor for glutamate, a key component of the taste of meat. So if you prepare bamboo for the pandas, don't bother with any MSG! But pandas do not appear to have acquired enzymes for attacking their bamboo, suggesting that their gut microflora do a lot of the work. So a panda ...

APIs: I wish the life sciences would learn from social networks

What You're Doing Is Rather Desperate — Fri, 11 Dec 2009 02:50:49 +0100

I was prompted by a thread on the apparent decline of FriendFeed to look for evidence of declining participation in my networks. First, a quick and dirty Ruby script, tls.rb to grab the Life Scientists feed and count the likes and comments: #!/usr/bin/ruby require 'rubygems' require 'json/pure' require 'net/http' require 'open-uri' def format_date(d) if d =~ /(\d{4}-\d{2}-\d{2})T(\d{2}:\d{2}:\d{2})Z/ return "#{$1},#{$2}" else return d end end def count_items(i) if i.nil? return 0 else return i.count end end n = ARGV[0] u = "http://friendfeed-api.com/v2/feed/the-life-scientists?start=#{n}" f = open(u).read j = JSON.parse(f) j.each_pair do |k,v| if k == "entries" v.each do |entry| date = format_date(entry['date']) likes = count_it...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Bioinformatics and mythology. You still need to manage the data

business|bytes|genes|molecules — Thu, 10 Dec 2009 03:43:17 +0100

Image by dullhunk via Flickr In a great blog post at Code for Life, Grant Jacobs writes By contrast, early bioinformatics work was almost invariably founded on biological concepts from the onset. A biological issue was raised and then a technique to address that issue was presented. That is, theoretical biology was the foundation on which [early] bioinformatics was built. I fear this is being lost in the mass-data and technology-hype driven bioinformatics. It seems to me that unless companies and research groups are careful many will waste time and money “stamp collecting and cataloging”. Certainly the organized data is useful, but only if it is applied with biological principles Grant writes this in the context of the early days of bioinformatics, a time when there was a lot of the...

Questions and information streams

business|bytes|genes|molecules — Tue, 08 Dec 2009 04:02:13 +0100

So Google announced a whole bunch of new features today. There are also rumors about Google making a play for Aardvark, a just-in-time social Q&A service that I like and use. This post is not about Google, nor about Aardvark per se, but rather about networks in science, and real time information flow. We ask questions in forums, in mailing lists, on Friendfeed; we search on Google, at NCBI; we track hashtags on Twitter. All of these questions and streams are flying by the web all the time, even in the sciences, but we have to go to various places to get access to them. What if I could sit at an interface and ask questions which land up in the right place, or allow me to track questions of interest being asked around the web and have those questions and their answers delivered to me? I ...

Playing with SOAP. Implementing a WebService for the LocusTree Server

YOKOFAKUN — Mon, 07 Dec 2009 00:00:00 +0100

In a previous post I've described the LocusTree server and showed how the wsimport command can be used to generate the java code that will query a Web-Service. Today, I've implemented a few web services in the LocusTree server but I wrote the entire code generating the SOAP messages rather than using the Java API for Web Services (JAXWS-API) because 1) I wanted to learn about the SOAP internals 2 (Source: YOKOFAKUN)

Scaling out for analytics

business|bytes|genes|molecules — Fri, 04 Dec 2009 16:57:19 +0100

Image via Wikipedia In a post announcing the open sourcing of Crane (more on Crane later), Bradford Cross writes A big concern with the modern JVM languages like Scala and Clojure is the ability to scale out from the single JVM address space into distributed environments. Different approaches include a distributed JVM (terracotta), distributed actors (akka), message queues (AMQP/rabbitmq), or solutions for specific computational models, like hadoop He also writes For those of us who are researchers, all our jobs are ad hoc transient clusters, and the problem is even more pronounced unless we have a dedicated research cluster, for the cluster must be brought up and torn down for every job. Researchers become “babysitters” to clusters and jobs; the master serves the servant. I...

Hadoop World video is out

business|bytes|genes|molecules — Wed, 02 Dec 2009 15:04:22 +0100

Cloudera posted my talk from Hadoop World Hadoop for Bioinfomatics – Deepak Singh from Cloudera on Vimeo. (Source: business|bytes|genes|molecules)

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Has our quest for completeness made things too complicated?

What You're Doing Is Rather Desperate — Wed, 02 Dec 2009 02:38:06 +0100

In my opinion, yes. Let me elaborate. My current job is very much focused on “data integration”. What this means is that we have a large amount of diverse data from different “-omics” experiments: microarrays, protein mass spectrometry, DNA sequencing – really, whatever you like, but it’s all aimed at answering the same question. Namely: which of these biological entities (transcripts, proteins, metabolites) are markers for various human disease states? Somehow, we have to pull all of these data into a common framework so that it can be analysed using statistics. The problem: whilst a lot of effort has gone into designing schema and ontologies that describe the individual data types, less effort has been applied to the question: what do all these things...

That’s what I was talking about

business|bytes|genes|molecules — Tue, 01 Dec 2009 01:29:16 +0100

But as things stand, change is the only constant. Bioinformatics is very much in flux, as the life sciences are quickly becoming a data science. In the future, small research projects will not only rely on high-throughput sequencing, but on bringing multiple systems-wide data sets to bear. Researchers will not be able to hire or train a developer as an afterthought. IT infrastructure is an absolute necessity at the inception of the project. The question is, where does it make most sense to manage IT resources, locally or remotely? The answer to that question will depend on an institution’s existing infrastructure. Large IT departments with a mature data center might be able to handle the capacity. But for small groups it make more sense to outsource the IT infrastructure to a growing, sc...

Open Science/Access challenge

Blind.Scientist — Mon, 30 Nov 2009 16:41:02 +0100

Image via Wikipedia A quick challenge, mainly because I’m lazy as hell to do these kind of things: if you advocate Open Science or Open Access, please leave a comment with your list of publications on PubMed or your own website/repository. (Source: Blind.Scientist)

A brief survey of R web interfaces

What You're Doing Is Rather Desperate — Mon, 30 Nov 2009 03:03:39 +0100

I’m looking at ways to provide access to R via a web application. First rule: see what’s available first, before you reinvent the wheel. It’s not pretty. From the R Web Interfaces FAQ: Software Brief notes Rweb Page last updated 1999. Of the 3 example links on the page one ran very slowly, the second not at all and the third is broken. R-Online Or rather, not online. Unless this CGI form is the same thing. I tried Example 1, it returned a server error. Rcgi Links to several CGI forms, none of which worked for me. CGI-based R access Link did not load. CGIwithR Package now maintained at Omegahat. Did not attempt installation. Last updated 2005. Rpad I could not connect to this URL. RApache The pick of the bunch. Provides server-side access to R through an Ap...

Playing with Erlang (II)

YOKOFAKUN — Mon, 30 Nov 2009 00:00:00 +0100

transcripting a DNA to a RNA sequence with an anonymous functionlists:map(fun($T)->$U;(OTHER)->OTHER end,"AATAGCTGATCGACAATGTTAGCTAGGC").>"AAUAGCUGAUCGACAAUGUUAGCUAGGC"Testing if a symbol is an acid nucleic> ACIDNUCLEICS="ATGCatgc"."ATGCatgc"> lists:member($A,ACIDNUCLEICS).true> lists:member($P,ACIDNUCLEICS).falseFiltering a sequence with lists:filter > IsAcidNucleic=fun(BASE)->lists:member(BASE, (Source: YOKOFAKUN)

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Academic software and infrastructure – AKA more ranting

business|bytes|genes|molecules — Sat, 28 Nov 2009 23:27:40 +0100

Perhaps no one will listen, but my one man movement against scientific web resources is going to continue, both for the access models as well as the funding models. Our two latest examples are the Robetta server and the SDSC protein structure homology modeling server. I found both as I looked for resources to solve a question posed by Jean-Claude. Here is what I ran into. With Robetta At this time, Robetta is only available for use by the academic community and other not-for-profit entities. I suppose that hobby scientists can be considered not-for-profit entities, but my previous two attempts to get access to software with similar language were not successful. We continue to be shackled by artificial boundaries and the artifacts of a system that needs to change, and fast. Admittedly, the...

Data platforms for science – From data to work

business|bytes|genes|molecules — Sat, 28 Nov 2009 00:12:58 +0100

At SC09, in my Systems Biology talk, I spoke about platforms for data. The idea is hardly original, since I’ve written about this before, and my ideas borrow heavily from Jeff Hammerbacher and Matt Wood among others. But I wanted to add some more meat to it in writing. Today we live in a world where we generate data from instruments, various experiments or simulations. These data can be used to provide us insights, and we want to add these insights to our data, capture those insights in the context of the data they represent and then keep track of the data and metadata for future changes. We do this in a world where data is generated by different people, different people care about different pieces of the follow on insights and information and perhaps a third set try and put this all...

DIALIGN-TX has all the problems with scientific software

Blind.Scientist — Thu, 26 Nov 2009 14:21:06 +0100

Image via Wikipedia Yes, DIALIGN-TX has all the problems with scientific software. All of them in 1.8 Mb of data, and I’m being kind. Let me explain that. I have this small project, and DIALIGN-TX is one of the programs I want to check. I compiled fine, or so I think: it runs ok on the Mac, shows me the parameters to run it, in a large list of options. Most of these options have a “DEFAULT” value, which means they are not needed to run the program. And there’s an usage example Usage: dialign-t [OPTIONS] [] (notice the error on the usage, I just copied and pasted) I tried every possible combination, with and without options, setting and not setting them, with different input files, no one worked. Then I decided to read the documentation. No true. First I decided ...

Playing with Erlang (I)

YOKOFAKUN — Thu, 26 Nov 2009 00:00:00 +0100

I'm currently reading Joe Armstrong's "Programming Erlang". Here are a couple of notes about ERLANG.Starting and stopping the Erlang shell:~> erlErlang R13B01 (erts-5.7.2) [source] [smp:2:2] [rq:2] [async-threads:0] [hipe] [kernel-poll:false]Eshell V5.7.2 (abort with ^G)1> halt().:~>Simple MathInput:2*(3+4).PI=3.14159.R=2.SURFACE=PI*R*R.R=3.Output:1> 142> 3.141593> 24> 12.56636##Variables in (Source: YOKOFAKUN)

A Java implementation of Jan Aerts' LocusTree

YOKOFAKUN — Thu, 26 Nov 2009 00:00:00 +0100

This post is a description of my implementation of Jan Aerts' LocusTree algorithm (I want to thank Jan, our discussion and his comments were as great source of inspiration) based on BerkeleyDB-JE, a Key/Value datastore. This implementation has been used to build a genome browser displaying its data with the SVG format. In brief: splicing each chromosome using a dichotomic approach allows to (Source: YOKOFAKUN)

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

The web becomes an even better platform for chemistry

business|bytes|genes|molecules — Wed, 25 Nov 2009 07:48:09 +0100

We recorded an episode of c2cbio earlier today and in that episode we talked about Chempedia and Chempedia Labs. I will avoid the main point of our discussion, and focus on the part that has me most interested in Chempedia. Rich Apodaca just plain gets the web. It’s not just the part about Chempedia being on Heroku, but a broader understanding of how content and APIs on the web should work. Here are some key aspects of Chempedia that I dig It’s social in the right way (the focus is on the chemistry, but allows you to find people) It is RESTful It understands search engines It uses CC0 In general, for months I have been following Rich’s work in making the web chemistry aware. He is certainly not the only one pushing chemistry on the web, but Rich understands the fundamen...

When timescales do not match

business|bytes|genes|molecules — Tue, 24 Nov 2009 08:20:39 +0100

One of the things that jumped out at me at SC09 as I sat through some talks on the challenges of handling the scale that we are beginning to face in the life sciences (I say beginning, cause we’re still in the early days) was that we are still not thinking about this in a manner that matches the rapid innovation that is happening at the instrument level. We innovate rapidly in instrument design. Even in the absence of innovation, we are facing a lot of change at the same time that we are generating more and more data. Unfortunately, our solutions are being developed on a traditional academic time scale and funding cycle, which from what I’ve experienced and continue to see, are not agile enough to keep pace with the rate of change or the type of change required. Operational sca...

A GPU community

business|bytes|genes|molecules — Tue, 24 Nov 2009 03:50:16 +0100

GPU’s have been a growing presence in scientific computing in recent years. All you have to do is see how busy NVidia’s booth is at Supercomputing these days. At SC09, the Coordinated Science Laboratory at UIUC announced gpucomputing.net, a “a research and development community dedicated to fostering collaborative and interdisciplinary work on the various disciplines that benefit from GPU computing.” The focus is on universities and academic research. While the site is open to all for viewing, but to participate you need to be a member, and and eligibility will be restricted to universities (I believe via a .edu address) or researchers/developers invited by a member. bbgm readers know that I have serious issues with that position as it locks out garage researchers ...

Targeted Sequencing Bags a Diagnosis

Omics! Omics! — Sun, 22 Nov 2009 00:00:00 +0100

This study again illustrates the utility of targeted sequencing for clinical diagnosis of difficult cases. While a whole exome scan is currently in the neighborhood of $20K, more focused searches could be run far cheaper. The challenge will be in designing economical panels which will allow scanning the most important genes at low cost and designing such panels well. Presumably one could go through OMIM and find all diseases & syndromes which alter electrolyte levels and known causative gene(s). Such panels might be doable for perhaps as low as $1-5K per sample; too expensive for routine newborn screening but far better than a endless stream of tests. Of course, such panels would miss novel genes or really odd presentations, so follow-up of negative results with whole exome sequencing migh...

A tool converting SVG to Canvas

YOKOFAKUN — Sun, 22 Nov 2009 00:00:00 +0100

This blogging platform, Blogger.com, does display its content in XHTML: in consequence, it is not possible to embedded a SVG picture in the body of a post. Solution: I've created a tool called that SVGToCanvas converts a SVG document to a Canvas script. The software is available here: http://code.google.com/p/lindenb/wiki/SVGToCanvas. For example, the picture below was a SVG file converted to (Source: YOKOFAKUN)

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Talks from SC09

business|bytes|genes|molecules — Thu, 19 Nov 2009 16:53:19 +0100

Up on slideshare Talk given at "Cloud Computing for Systems Biology" workshop View more documents from Deepak Singh. Masterworks talk on Big Data and the implications of petascale science View more documents from Deepak Singh. All talks can be found here (Source: business|bytes|genes|molecules)

Revisiting data and people

business|bytes|genes|molecules — Thu, 19 Nov 2009 07:01:56 +0100

Image via Wikipedia I’ve written and talked a lot about data finding data and then people finding people. Today, someone asked me what that meant in the context of social networks, etc and we ended up with a pretty good example of that concept. I have two networks – science and music (the data), and the networks related to both (the people). The two networks do not really overlap. In other words since there is no common data, the people are not finding the people. On the other hand, the science and programming networks have some overlap and those people do find each other. I wonder how generalizable this concept is and if there have been any analyses along those lines. Michael, any ideas? (Source: business|bytes|genes|molecules)

Three Blows Against the Tyranny of Expensive Experiments

Omics! Omics! — Thu, 19 Nov 2009 00:00:00 +0100

Second generation sequencing is great, but one of it's major issues so far is that the cost of one experiment is quite steep. Just looking at reagents, going from a ready-to-run library to sequence data is somewhere in the neighborhood of $10K-25K on 454, Illumina, Helicos or SOLiD (I'm willing to take corrections on these values, though they are based on reasonable intelligence). While in theory you can split this cost over multiple experiments by barcoding, that can be very tricky to arrange. Perhaps if core labs would start offering '1 lane of Illumina - Buy It Now!' on eBay the problem could be solved, but finding a spare lane isn't easy. This issue manifests itself in other ways. If you are developing new protocols anywhere along the pipeline, your final assay is pretty expensive, mak...

Turn Emacs into an IDE

What You're Doing Is Rather Desperate — Wed, 18 Nov 2009 03:47:32 +0100

I fired up NetBeans at work today, tried to open a Rails project and – inexplicably, it crashed. All is well at home, so I’m blaming work machine setup issues as-yet unknown (but I suspect, involving the letters “ATI”). It got me thinking that, as much as I like NetBeans, it is still just a memory-eating, CPU-hogging, bloated Java-based GUI. For some time I’ve wanted to convert my favourite editor, Emacs, to something more like an IDE. It's Emacs, but not as we know it The WyeWorks Blog to the rescue. Install emacs-23 and a couple of Ruby gems, clone their github repository of Emacs plugins, copy to your ~/.emacs.d/ and voilà – marvel at your new, shiny editing environment. I also replaced my ~/.emacs with their init.el file. The key plugins include ECB...

Decode -- Corpse or Phoenix?

Omics! Omics! — Tue, 17 Nov 2009 00:00:00 +0100

The news that Decode has filed for bankruptcy is a sad milestone in the history of genomics companies. Thus falls either the final or penultimate human gene mapping companies, with everyone else having either disappeared entirely or exited that business. A partial list would include Sequana, Mercator, Myriad, Collaborative Research/Genome Therapeutics, Genaera and (of course) Millennium. I'm sure I'm missing some others. The one possible survivor I can think about is Perlegen, though their website is pretty bare bones, suggesting they have exited as well.The challenge all of these companies faced, and rarely beat, was how to convert mapping discoveries into a cash stream which could pay for all that mapping. Myriad could be seen as the one success, having generated the controversial BRCA t...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

A New Type of Scroll Bar (for PDF files)

Trapped in the USA — Mon, 16 Nov 2009 06:57:03 +0100

Ever since I brought home my large 22” monitor, I’ve been trying to read more PDF files on the computer instead of printing them out on paper first. But there is something lacking in reading from a computer screen. The thing I miss most is that I lose a sense of place in a document. With the document printed on pages of paper, I get a physical sense of where I am simply from the feel of the thickness of the pages and from the physical act of turning a page. I can scan quickly through the document and find certain sections much faster than reading on the computer. In comparison, a typical PDF viewer only gives you a very poor sense of place in a document via a scrollbar. This does not provide you with any way to scan ahead: However, many PDF viewers also provide a thumbn...

Michael Nielsen on notability in Wikipedia

business|bytes|genes|molecules — Sun, 15 Nov 2009 17:46:04 +0100

Michael Nielsen has a great piece on notability in Wikipedia which he calls The Wikipedia Paradox But suppose I went to great trouble to convene a conference series on The Answer, was able to convince leading logicians and philosophers to take part, writing papers about The Answer, convinced a prestigious journal to publish the proceedings, arranged media coverage, and so on. The Answer would then certainly have exceeded Wikipedia’s notability guidelines! Related to this (Source: business|bytes|genes|molecules)

Targeted Sequencing Bags a Rare Disease

Omics! Omics! — Sun, 15 Nov 2009 00:00:00 +0100

Nature Genetics on Friday released the paper from Jay Shendure, Debra Nickerson and colleagues which used targeted sequencing to identify the damaged gene in a rare Mendelian disorder, Miller syndrome. The work had been presented at least in part at recent meetings, but now all of us can digest it in entirety.The impressive economy of this paper is that they targeted (using Agilent chips) less than 30Mb of the human genome, which is less than 1%. They also worked with very few samples; only about 30 cases of Miller Syndrome have been reported in the literature. While I've expressed some reservations about "exome sequencing", this paper does illustrate why it can be very cost effective and my objections (perhaps not made clear enough before) is more a worry about being too restricted to "ex...

600 years of paintings: Part 1

YOKOFAKUN — Sun, 15 Nov 2009 00:00:00 +0100

It's a lazy sunday, It's raining, it's dark, it's cold.. so I'm playing with the mediawiki API, wikipedia commons and some of my programs to fetch one painting per year since the 15th century. Here is the script:JE=je-4.0.71.jar:API=http://commons.wikimedia.org/w/api.phpecho "";for CENTURY in `seq 14 19`do echo (Source: YOKOFAKUN)

600 years of paintings: Part 2

YOKOFAKUN — Sun, 15 Nov 2009 00:00:00 +0100

16th century.1500Pietro Perugino 061.1501Pietro Perugino 051.1502Vittore Carpaccio 001503Albrecht Dürer 050.j1504Raffaello - Spozaliz1505Lorenzo Lotto 006.jp1506Lucas Cranach d. Ä. 1507Adam et Eve.jpg1508Albrecht Dürer 066b.1509Sibyl of Delphi - Si1510Lorenzo Lotto 025.jp1511Raffael 055.jpg1512TitianFirstAretinoPo1513GaudenzioFerrari Sto1514Vittore Carpaccio 051515Bernhard Strigel 0041516Hans (Source: YOKOFAKUN)

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

600 years of paintings: Part 3

YOKOFAKUN — Sun, 15 Nov 2009 00:00:00 +0100

17th century.1600Bernardo Strozzi - S1601Bril, Paul - Feudo d16023233 - Milano, Duomo1603Jan Brueghel d.Ä.- G1604Felipe Manuel, Princ1605Peter Paul Rubens 121606Rottenhammer Hochzei1607Bassot-Saint-Christo1608Alof Louvre.jpg1609ElGreco-HortensioPar1610Gregorythegreat.jpg1611Jan Brueghel the Eld1612Peter Paul Rubens 011613MariadeMedici11.jpg1614FishersOfMen.jpg1615Peter Paul Rubens 081616Peter (Source: YOKOFAKUN)

600 years of paintings: part 4

YOKOFAKUN — Sun, 15 Nov 2009 00:00:00 +0100

18th century.1700Sebastiano Ricci 0301701Coypel, Antoine - El1702Sir Isaac Newton 1701703Houbraken, Arnold - 1704Sebastiano Ricci 0421705Florinus Astronomy 11706Sebastiano Ricci 0181707Sebastiano Ricci 0121708Sebastiano Ricci 0041709Giuseppe Maria Cresp1710Christian Ludwig Mar1711Nusplingen Friedhofs1712Jan Dobrogost Krasiń1713Sebastiano Ricci 0601714Allegory on the Peac1715Antoine Watteau (Source: YOKOFAKUN)

600 years of paintings: part 5

YOKOFAKUN — Sun, 15 Nov 2009 00:00:00 +0100

19th century.1800The Meeting of Orest1801Montreal Isle Sainte1802Joseph Mallord Willi1803HenriettevonHeintze11804York 1804 Hale.jpg1805Елизавета Алексеевна1806Death of Nelson.jpg1807Joseph Mallord Willi1808Pierre-Narcisse Guér1809CBell1809.jpg1810John Johnston - Stil1811IngresJupiterAndThet1812JE Wilmot by Benjami1813Lieutenant Provo Wil1814Cathedral of Turku 11815Betty Gleim - Portra1816Debret (Source: YOKOFAKUN)

600 years of paintings: Part 6

YOKOFAKUN — Sun, 15 Nov 2009 00:00:00 +0100

20th century.1900Charles Warren Eaton1901Prinet - Kreutzer So1902Ryabushkin dance.jpg1903Bobrikov by Kustodie1904Bertha Worms - Cançã1905Elizabeth Drexel.jpg1906Friedrich Kallmorgen1907Lawrence Alma-Tadema1908Thomas Moran - Grand1909George Bellows - Les1910Баян.jpg1911Checa Y Sanz Ulpiano1912Compton, 1912, Mount1913M.O.Lowenfeld by Rep1914Antônio Parreiras - 1915Amadeo Modigliani 011916Gustav (Source: YOKOFAKUN)

Sharing Tracklogs

eric.jain.name — Fri, 13 Nov 2009 02:12:17 +0100

While hiking, I often carry along a small GPS device to record my tracks. This is not just useful in case I get lost and need to backtrack, but also allows me to geotag my pictures before uploading them. Plus it can be fun to review a hike in Google Earth. What about sharing tracklogs? [...] (Source: eric.jain.name)

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Old books

Trapped in the USA — Thu, 12 Nov 2009 07:58:54 +0100

I recently went to the San Francisco Public Library Book Fair. In an aircraft hangar of a warehouse, billions and billions of used books were arranged over miles and miles of old folding tables. Readers from all over the bay area (and some beyond I might imagine) pored over the dessicated remains of someone else’s poor reading habits. Some even pushed trolley carts to carry all of their booty. Over the years I’ve gotten picky with my reading and I prefer to buy wanted books instead of reading what lays at hand. But still after an afternoon of triage at the book fair, I found some out-of-print gems. The first was a ratty old Dover book complete with a sickly green cover titled “Aquatic Mammals: Their Adaptations to Life in the Water” by a former president of th...

A 10,201 Genomes Project

Omics! Omics! — Thu, 12 Nov 2009 00:00:00 +0100

With valuable information emerging from the 1000 (human) genomes project and now a proposal for a 10,000 vertebrate genome project, it's well past time to expose to public scrutiny a project I've been spitballing for a while, which I now dub the 10,201 genomes project. Why that? Well, first it's a bigger number than the others. Second, it's 101 squared.Okay, perhaps my faithful assistant is swaying me, but I still think it's a useful concept, even if for the time being it must remain a gehunden experiment. All kidding aside, the goal would be to sequence the full breadth of caninity with the prime focus on elucidating the genetic machinery of mammalian morphology. In my biological world, that would be more than enough to justify such a project once the price tag comes down to a few million...

A call for new technological minds for the genome sequencing instrument fields

Omics! Omics! — Wed, 11 Nov 2009 00:00:00 +0100

There's a great article in the current Nature Biotechnology (alas, you'll need a subscription to read the full text) titled "The challenges of sequencing by synthesis" as this post detailing the challenges around the current crop of sequencing-by-synthesis instruments. The paper was written by a number of the PIs on grants for $1K genome technology.While there is one short section on the problem of sample preparation, the heart of the paper can be found in the other headings: surface chemistryfluorescent labelsthe enzyme-substrate systemopticsthroughput versus accuracyread-length and phasing limitationsEach section is tightly written and well-balanced, with no obvious playing of favorites or bashing of anti-favorites present. Trade-offs are explored & the dreaded term (at least amongst sci...

Occult Genetic Disease

Omics! Omics! — Tue, 10 Nov 2009 00:00:00 +0100

A clinical aside by Dr. Steve over at Gene Sherpas piqued my interested recently. He mentioned a 74 year old female patient of his with lung difficulties who turned out positive both by the sweat test and genetic testing for cystic fibrosis. One of her grandchildren had CF, which appears to have been a key hint in this direction. This anecdote was particularly striking to me because I had recently finished Atul Gawande's "Better" (highly recommended), which had a chapter on CF. Even today, a well treated CF patient living to such an age would be remarkable; when this woman was born living to 20 would be lucky. Clearly she either has a very modest deficit or some interesting modifier or such (late onset?) which allowed her to live to this age.Now, if this patient didn't have any CF in her f...

A Cartography of Gorgeous French Music of the last Decade

Trapped in the USA — Mon, 09 Nov 2009 08:48:25 +0100

I got a taste for French music living in Belgium almost ten years ago. Before living in francophile Brussels, I had formed, in my adolescent mind, a world populated by languorous women with a detached air of cultured sensuality, whispering an unending stream of soft slurred vowels running over each other like waves on a soft beach. The sound of French does not posses the cut and thrust of English, where the profane and the sexual are cleaved into the puritan and the lustful. In French, every act is a sensual act. Coralie Clément But they never tell you how difficult it is to explore the musical landscape of another language. Indeed, I had forgotten my own experience as a unmanned adolescent trying to get to grips with the mysteries of the Top 40 and other such things. Figu...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

Building a simple Expression language with JJTree/Javacc . My Notebook

YOKOFAKUN — Mon, 09 Nov 2009 00:00:00 +0100

Last year, I described how to use the JAVACC a parser/scanner generator for java. This WE, I've played with JJTREE: JJTree is a preprocessor for JavaCC that inserts parse tree building actions at various places in the JavaCC source.. Here I describe how to build a simple expression language to find an object in a simple 'JSON 'object only built with arrays, java.util.List, java.util.Map, String, (Source: YOKOFAKUN)

Duncan Hull's blog has moved

nodalpoint.org - A bioinformatics weblog — Fri, 06 Nov 2009 20:26:55 +0100

If you're here looking for Duncan Hull's blog, it has moved to O'Really?. Nodalpoint lives on at nodalpoint.org. (Source: nodalpoint.org - A bioinformatics weblog)

Warren Delano passes away

business|bytes|genes|molecules — Fri, 06 Nov 2009 06:18:15 +0100

Earlier today, I got an email from Hari pointing me to a note from Axel Brunger on the CCP4 mailing list with the sad news that Warren Delano had passed away. I got to know Warren during my time at Accelrys, and was lucky enough to discuss science and visualization with him on more than one occasion (we didn’t exactly agree on everything, but it was always a healthy debate), so I am still trying to absorb the news. To say it is shocking would be an understatement For those who don’t know, Warren was the author of PyMol, the best pure viewer I have ever used, and a revolution in it’s day. An open source viewer better than anything you paid for. It was certainly a key reason why companies like Accelrys ended up releasing free molecular viewers. Seeing slide after slide at c...

Handling RDF Statements with Apache Velocity

YOKOFAKUN — Fri, 06 Nov 2009 00:00:00 +0100

This post is about using Apache Velocity ( a Java-based template engine ) and the Jena RDF library. My aim was to use Velocity to handle the content of one or more RDF store without compiling, just by using a custom velocity template. This idea was much inspired by Egon Willighagen's posts where the RDF was handled with a scripting engine embedded in bioclipse. It also seems that I'm not the (Source: YOKOFAKUN)

My PDFs anywhere.

YOKOFAKUN — Fri, 06 Nov 2009 00:00:00 +0100

A short post: I was asked to write a web server to allow people access their PDFs when they are away from the laboratory. People enter a Doi, a PMID or the URL of the page and the system tries to retrieve the PDF using a set of pre-defined patterns (e.g. the PDF of http://www.pnas.org/content/X/Y/Z is http://www.pnas.org/content/X/Y/Z.full.pdf ). This idea was suggested by Chris Miller on (Source: YOKOFAKUN)

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

R has a JSON package

What You're Doing Is Rather Desperate — Thu, 05 Nov 2009 23:44:44 +0100

Named rjson, appropriately. It’s quite basic just now, but contains methods for interconversion between R objects and JSON. Something like this: > library(rjson) > data <- list(a=1,b=2,c=3) > json <- toJSON(data) > json [1] "{\"a\":1,\"b\":2,\"c\":3}" > cat(json, file="data.json") Use cases? I wonder if RApache could be used to build an API that serves R data in JSON format? Posted in computing, R, statistics Tagged: cran, json, r-project, statistics (Source: What You're Doing Is Rather Desperate)

Brief notes on Ubuntu 9.04 (jaunty) -> 9.10 (karmic)

What You're Doing Is Rather Desperate — Mon, 02 Nov 2009 08:18:12 +0100

Recording my Ubuntu upgrade experience has become something of a tradition, so here goes. Machine 1 (laptop, LG T1 Express Duo). Largely trouble-free. On-board soundcard not seen on reboot. Fixed (temporarily, lost on reboot) using “sudo alsa force-reload”. Machine 2 (various generic hardware, cobbled together over many years). Upgrade smooth until final restart, when machine froze. Rebooted to a blank screen. Fixed by swapping out ATI video card for old NVidia FX5200. Discovered that rsyslog is running riot due to a hot CPU and is trying to fill up /var/log. Machine 3 (Dell Optiplex GX550). Install froze at “stopping winbind server”. Rebooted with rescue CD, mounted and chroot-ed into Linux partition, tried “dpkg –force-all –configure -a”, ...

Data driven science revisited

business|bytes|genes|molecules — Sat, 31 Oct 2009 17:50:35 +0100

Chris Anderson once infamously wrote The data deluge makes the scientific method obsolete, an opinion that I do not share. Eric Drexler on the other hand comes at this new age of data driven science with the right mindset. In a post on data explosion and the scientific method, Eric writes Tradition demands that science always be hypothesis-driven: First, try to guess the truth, and only afterward collect experimental data to test whether the guess predicts the results. Indeed, this has been termed “The Scientific Method”. The new data-driven approach suggests that we collect data first, then see what it tells us. This becomes practical when experimental methods can amass enormous amounts of data, enough data to test more hypotheses than any mortal scientist could conceivably imagine. T...

Matt’s manifesto for a science data platform

business|bytes|genes|molecules — Thu, 29 Oct 2009 03:37:13 +0100

There are a select few people whose every word I try and absorb and chew on because I have great respect for their thinking and intelligence. Matt Wood is one of those people, and today he decided to tweet a manifesto. The whole series started with I’m starting a manifesto. There are no technical, political or funding reasons why an open data platform for science couldn’t excel He then followed that up with five tweets (Matt’s Twitter stream). I don’t know if that’s the entire manifesto, but I reproduce those tweets below, a series entitled Towards a science data platform Easy, flexible retrieval and reuse above all else A laser sharp focus on scientific productivity and progress Scalability and speed are not mutually exclusive Well designed, high quality pro...

My Most Expensive Paper

Omics! Omics! — Thu, 29 Oct 2009 00:00:00 +0100

Genome Research has a paper detailing the Mammalian Gene Collection (MGC), and if you look way down on the long author list (which includes Francis Collins!) you'll see mine there along with two Codon Devices colleagues. This paper cost me a lot -- nothing in legal tender, but a heck of a lot of blood, sweat & tears.The MGC is an attempt to have every human & mouse protein coding sequence (plus more than a few rat)available as an expression clone, with native sequence. Most of the genes were cloned from cDNA libraries, but coding sequences which couldn't be found that way were farmed out to a number of synthetic biology companies. Codon decided to take on a particularly challenging tranche of mostly really long ORFs, hoping to demonstrate our proficiency in this difficult task.At the start...

MedWorm Message: Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.

HPC and software … again

business|bytes|genes|molecules — Tue, 27 Oct 2009 02:30:43 +0100

Software is really becoming the broader language of science. Even broader than mathematics, but we don’t really know how to fund it. Those are words from Ed Seidel, Director of the NSF’s Office of Cyberinfrastructure. They are included in an article at Inside HPC, where Ed tries to clear up the air on some controversial positions on the status of supercomputing software. Whether you agree with Ed Seidel on whether Fortran is antiquated or not, it’s pretty clear, and not just in HPC that science does not know how to fund sustainable software development, and if we do want to get a generation of programmers into scientific computing, we have to embrace more “modern” programming languages, or develop our own, because whether you like it or not, getting good Fortran p...

DTC CNVs?

Omics! Omics! — Mon, 26 Oct 2009 00:00:00 +0100

Curiosity question: do the current DTC genomics companies report out copy number variations (CNVs) to their customers? Are any of their technologies unable to read these? Clearly Knome (or Illumina, which isn't DTC but sort of competing with them) should be able to get this info from the shotgun sequencing. But what about the array-based companies such as Navigenics & 23andMe? My impression is that any high density SNP array data can be mined for copy number info, but perhaps there are caveats or restrictions on that. It would seem that with CNVs so hot in the literature and a number of complex diseases being associated to them, this would be something the DTC companies would jump at. But have they? (Source: Omics! Omics!)

The bioinformatic-journal/software hydrid

Trapped in the USA — Sun, 25 Oct 2009 15:46:48 +0100

The real bioinformatics journal has not been created yet. Wait, let me explain. What we currently have are traditional journals that deal with articles on bioinformatics. The journal themselves, though they may provide digital PDF files, are still stuck in the paper paradigm. The journal itself is not bioinformatic. What crack am I smoking? In a recent article on the future of science publishing, Michaell Nielsen speculates that the crunch in scientific publishing will not simply lead to an age of open-access science publishing, but in all likelihood, will lead to new forms of publishing centered around services. Well there’s one service that I wish bioinformatics journals provide. How about actually providing what you promise? Here’s the situation. You find an 6 year old ...

Now where did I misplace that genome segment of mine?

Omics! Omics! — Sat, 24 Oct 2009 00:00:00 +0100

One of the many interesting ASHG tidbits from the Twitter feed is a comment from "suganthibala" which I'll quote in fullOn average we each are missing 123 kb. homozygously. An incomplete genome is the norm. What a goofy species we are..I'm horribly remiss in tracking the CNV literature, but this comment makes me wonder whether this is atypical at all. How extensively has this been profiled in other vertebrate species and how do other species look in terms of the typical amount of genome missing? I found two papers for dogs, one of which features a former lab mate as senior author and the other one has Evan Eichler in the author list. Some work has clearly been done in mouse as well. Presumably there is some data for Drosophila, but how extensive? Are folks going through their collections o...