MedWorm.com provides a medical RSS filtering service. Over 6000 RSS medical sources are combined and output via different filters. This feed contains the latest items from the 'Analytical Biochemistry' source. Thu, 09 Feb 2012 13:38:25 +0100 http://www.medworm.com/index.php?rid=5672765&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22310497%26dopt%3DAbstract Authors: Wakamori M, Umehara T, Yokoyama S Abstract We developed a novel nucleosome DNA template vector, pWMD01, which is optimized for the large-scale preparation of nucleosomal DNA. By using restricted digestion by SapI or EarI within its multicloning site, multiple half-nucleosome DNA units can be introduced unidirectionally into the vector at each subcloning step. Through this method, we constructed a plasmid that has 18 tandem repeats of a half-nucleosome 90-bp DNA unit containing c-Myb-binding sites in two subcloning cycles. This method enables the rapid, large-scale preparation of nucleosomal DNA with crystallization-grade quality. PMID: 22310497 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5672765 Thu, 26 Jan 2012 05:00:00 +0100 5672765 http://www.medworm.com/index.php?rid=5672764&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22310498%26dopt%3DAbstract Authors: Back P, Matthijssens F, Vanfleteren JR, Braeckman BP Abstract Because superoxide is involved in various physiological processes, many efforts have been made to improve its accurate quantification. We optimized and validated a superoxide-specific and -sensitive detection method. The protocol is based on fluorescence detection of the superoxide-specific hydroethidine (HE) oxidation product, 2-hydroxyethidium. We established a method for the quantification of superoxide production in isolated mitochondria without the need for acetone extraction and purification chromatography as described in previous studies. PMID: 22310498 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5672764 Tue, 24 Jan 2012 05:00:00 +0100 5672764 http://www.medworm.com/index.php?rid=5672762&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22310500%26dopt%3DAbstract We present a method for real-time examination of the protein-protein interactions between RGS and Gα subunits. AtRGS1 from plants and RGS4 from mammals were site-directedly labeled with the fluorescent probe Lucifer yellow on engineered cysteine residues and used to interact with different Gα subunits. The physical interactions can be revealed by monitoring the real-time fluorescence changes (8.6% fluorescence increase in mammals and 27.6% in plants); their correlation to functional exertion were shown with a GTPase accelerating activity assay and further confirmed by measurement of K(d). We validate the effectiveness of this method and suggest its application to the exploration of more RGS signaling partner proteins in physiological and pathological studies. PMID: 22310500 [PubMed -... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5672762 Tue, 24 Jan 2012 05:00:00 +0100 5672762 http://www.medworm.com/index.php?rid=5672768&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22306471%26dopt%3DAbstract Authors: Kozak RP, Royle L, Gardner RA, Fernandes DL, Wuhrer M Abstract The analysis of O-glycans is essential for better understanding their functions in biological processes. Although many techniques for O-glycan release have been developed, the hydrazinolysis release method is the best for producing O-glycans with free reducing termini in high yield. This release technique allows the glycans to be labeled with a fluorophore and analyzed by fluorescence detection. Under the hydrazinolysis release conditions, a side reaction is observed and causes the loss of monosaccharides from the reducing terminus of the glycans (known as peeling). Using bovine fetuin (because it contains the sialylated O-glycans most commonly found on biopharmaceuticals) and bovine submaxillary gland mucin (B... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5672768 Fri, 20 Jan 2012 05:00:00 +0100 5672768 http://www.medworm.com/index.php?rid=5672767&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22306473%26dopt%3DAbstract Authors: Yildiz AA, Knoll W, Gennis RB, Sinner EK Abstract The analysis of membrane proteins is notoriously difficult because isolation and detergent-mediated reconstitution often results in compromising the protein structure and function. We introduce a novel strategy of combining a cell-free expression method for synthesis of a protein species coping with one of the most important obstacles in membrane protein research-preserving the structural-functional integrity of a membrane protein species and providing a stable matrix for application of analytical tools to characterize the membrane protein of interest. We address integration and subsequent characterization of the cytochrome bo(3) ubiquinol oxidase (Cyt-bo(3)) from de novo synthesis without the effort of conventional cell cu... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5672767 Fri, 20 Jan 2012 05:00:00 +0100 5672767 http://www.medworm.com/index.php?rid=5672769&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22289691%26dopt%3DAbstract Authors: Morneau DJ, Abouassaf E, Skanes JE, Aitken SM Abstract Threonine synthase (TS) catalyzes the hydrolysis of O-phospho-l-homoserine (OPHS) to produce l-threonine (l-Thr) and inorganic phosphate. Here, we report a simplified purification protocol for the OPHS substrate and a continuous, coupled-coupled, spectrophotometric TS assay. The sequential actions of threonine deaminase (TD) and hydroxyisocaproate dehydrogenase (HO-HxoDH) convert the l-Thr product of TS to α-ketobutyrate (α-KB) and then to 2-hydroxybutyrate, respectively, and are monitored as the decrease in absorbance at 340nm resulting from the concomitant oxidation of β-nicotinamide adenine dinucleotide (NADH) to NAD(+) by HO-HxoDH. The effect of pH on the activities of Escherichia coli TD and Lactobacillus delbr... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5672769 Wed, 18 Jan 2012 05:00:00 +0100 5672769 http://www.medworm.com/index.php?rid=5672766&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22306474%26dopt%3DAbstract This article shows that a combination of WISH with LCM and subsequent RT-qPCR is a robust strategy to qualitatively and quantitatively analyze differential miRNA expression in discrete cell types of a single blastocyst. PMID: 22306474 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5672766 Wed, 18 Jan 2012 05:00:00 +0100 5672766 http://www.medworm.com/index.php?rid=5672763&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22310499%26dopt%3DAbstract Authors: Lee H, Torres J, Truong L, Chaudhuri R, Mittal A, Johnson ME Abstract High-throughput screening (HTS) of large compound libraries has become a commonly used method for the identification of drug leads, and nonphysiological reducing agents have been widely used for HTS. However, a comparison of the difference in the HTS results based on the choice of reducing agent used and potency comparisons of selected inhibitors has not been done with the physiological reducing agent reduced glutathione (GSH). Here, we compared the effects of three reducing agents-dithiothreitol (DTT), β-mercaptoethanol (β-MCE), and tris(2-carboxyethyl)phosphine (TCEP)-as well as GSH against three drug target proteins. Approximately 100,000 compounds were computationally screened for each target prote... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5672763 Wed, 18 Jan 2012 05:00:00 +0100 5672763 http://www.medworm.com/index.php?rid=5672770&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22289690%26dopt%3DAbstract Authors: Prather B, Ethen CM, Machacek M, Wu ZL Abstract Sulfotransferases are a large group of enzymes that transfer a sulfonate group from the donor substrate, 3'-phosphoadenosine-5'-phosphosulfate (PAPS)(1), to various acceptor substrates, generating 3'-phosphoadenosine-5'-phosphate (PAP) as a by-product. A universal phosphatase-coupled sulfotransferase assay is described here. In this method, Golgi-resident PAP-specific 3'-phosphatase (gPAPP) is used to couple to a sulfotransferase reaction by releasing the 3'-phosphate from PAP. The released phosphate is then detected using malachite green reagents. The enzyme kinetics of gPAPP have been determined, which allows calculation of the coupling rate, the ratio of product-to-signal conversion, of the coupled reaction. This assay is ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5672770 Tue, 17 Jan 2012 05:00:00 +0100 5672770 http://www.medworm.com/index.php?rid=5637068&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22274539%26dopt%3DAbstract In conclusion, we have developed an improved method to quantify H(2)S generated in vitro. This method could be used to screen compounds to identify potential H(2)S donors and inhibitors for therapeutic use. PMID: 22274539 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5637068 Tue, 10 Jan 2012 05:00:00 +0100 5637068 http://www.medworm.com/index.php?rid=5637079&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22266207%26dopt%3DAbstract Authors: Mao K, Wu D, Li Y, Ma H, Ni Z, He S, Luo C, Wei Q, Du B Abstract For the specificity of prostate cancer markers, protsate specific antigen (PSA) has been widely used in prostate cancer screening, diagnosis, and treatment after monitoring. In normal male serum, PSA can only be detected in traces of 0-4ngmL(-1). In this paper, we constructed an electrochemical immunosensor for PSA detection using a nanocomposite film of graphene sheets-methylene blue-chitosan (GS-MB-CS) as electrode material. The nanocomposite film showed high binding affinity to the electrode and was used to immobilize the antibody of PSA. The modification procedure was monitored by cyclic voltammetry (CV). An amperometric biosensor was easily developed based on the response of peak current to the capture o... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5637079 Sun, 08 Jan 2012 05:00:00 +0100 5637079 http://www.medworm.com/index.php?rid=5637078&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22266208%26dopt%3DAbstract Authors: Kasari M, Padrik P, Vaasa A, Saar K, Leppik K, Soplepmann J, Uri A Abstract A novel nonmetal optical probe ARC-1063 whose long-lifetime luminescence is induced by association with the target protein kinase is used for the measurement of the concentration of catalytic subunit of protein kinase A (PKAc) in complicated biological solutions. High affinity (K(D)=10pM toward PKAc) and unique optical properties of the probe enable its application for the measurement of picomolar concentrations of PKAc in the presence of high concentrations of other proteins. The described assay is applicable in the high-throughput format with the instrument setups designed for lanthanide-based time-gated (time-resolved) luminescence methods. The assay is used for demonstration that extracellular ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5637078 Sun, 08 Jan 2012 05:00:00 +0100 5637078 http://www.medworm.com/index.php?rid=5637073&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22266295%26dopt%3DAbstract Authors: Sezgintürk MK, Uygun O Abstract In the present work, we have developed a new biosensor based on fourth-generation (G4) PAMAM dendrimers for the analysis of vascular endothelial growth factor (VEGF). First, the PAMAM dendrimers were covalently attached to a cysteamine-modified Au electrode by glutaraldehyde. With the help of the amino groups located on its surface, vascular endothelial growth factor receptor-1 (VEGF-R1) was immobilized via glutaraldehyde cross-linking. VEGF-R1 loading was investigated to identify the optimal VEGF-R1 immobilization conditions for the best sensitivity of the new biosensor. In addition, Kramers-Kronig transforms were also analyzed for immobilization and measurement processes. The biosensor had a linear range of 5 to 125pg/mL VEGF. The fabrica... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5637073 Sun, 08 Jan 2012 05:00:00 +0100 5637073 http://www.medworm.com/index.php?rid=5637072&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22266296%26dopt%3DAbstract We present here a resonance Rayleigh scattering (RRS) method for the determination of heparin at the nanogram level using gemini surfactant (dodecyl polyoxyethylene ether biquaternary ammonium salt, DPBAS). It was found that DPBAS could react with anionic heparin to form an ion-association complex, which induced the enhancement of RRS intensity and the appearance of a new RRS spectrum in Britton-Robinson buffer (pH 5.5). The RRS spectral characteristics of the heparin-DPBAS system, the optimum conditions of the reaction, and the influencing factors have been investigated. Under the optimum conditions, the enhanced RRS intensity (ΔI(RRS)) was proportional to the concentration of heparin in the range of 0.05-0.6μg/mL. The method has high sensitivity, and the detection limit for heparin is ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5637072 Sun, 08 Jan 2012 05:00:00 +0100 5637072 http://www.medworm.com/index.php?rid=5637071&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22266297%26dopt%3DAbstract Authors: Sueda S, Tanaka S, Inoue S, Komatsu H Abstract Genetically encoded tags attached to proteins of interest are widely exploited for proteome analysis. Here, we present Tb(3+)-binding peptides (TBPs) which can be used for both luminescent measurements and affinity purification of proteins. TBPs consist of acidic amino acid residues and tryptophan residues which serve as Tb(3+)-binding sites and sensitizers for Tb(3+) luminescence, respectively. The Tb(3+) complexes of TBPs fused to a target protein exhibited luminescence characteristic of Tb(3+) by excitation of the tryptophan residue, and fusion proteins fused to one of the TPBs were successfully isolated from Escherichia coli cell lysate by affinity chromatography with a Tb(3+)-immobilized solid support. PMID: 22266297 ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5637071 Sun, 08 Jan 2012 05:00:00 +0100 5637071 http://www.medworm.com/index.php?rid=5637067&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22281394%26dopt%3DAbstract Authors: Williams AK, Dasilva SC, Bhatta A, Rawal B, Liu M, Korobkova EA Abstract Therapeutic drugs and environmental pollutants may exhibit high reactivity toward DNA bases and backbone. Understanding the mechanisms of drug-DNA binding is crucial for predicting their potential genotoxicity. We developed a fluorescence analytical method for the determination of the preferential binding mode for drug-DNA interactions. Two nucleic acid dyes were employed in the method: TO-PRO-3 iodide (TP3) and 4',6-diamidino-2-phenylindole (DAPI). TP3 binds DNA by intercalation, whereas DAPI exhibits minor groove binding. Both dyes exhibit significant fluorescence magnification on binding to DNA. We evaluated the DNA binding constant, K(b), for each dye. We also performed fluorescence quenching expe... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5637067 Sun, 08 Jan 2012 05:00:00 +0100 5637067 http://www.medworm.com/index.php?rid=5637076&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22266292%26dopt%3DAbstract Authors: Ramani D, Nakib S, Chen H, Garbay C, Loukaci A, Cynober L, De Bandt JP Abstract Citrulline, a key amino acid of the urea cycle, has been shown to play a regulatory role in protein and energy metabolism in mammals. We questioned whether N-carbamoyl-putrescine (NCP), the decarboxylated derivative of citrulline, could play a role in the biological properties of this amino acid. To evidence the presence of NCP in mammalian tissues, we developed a sensitive reverse-phase high-performance liquid chromatography (HPLC) with fluorimetric detection method with precolumn dansyl derivatization and solid-phase extraction for the determination of NCP together with polyamines in biological samples. Dansyl NCP was identified with a 5.85-min retention time. Linearity was obtained in a conc... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5637076 Wed, 04 Jan 2012 05:00:00 +0100 5637076 http://www.medworm.com/index.php?rid=5637075&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22266293%26dopt%3DAbstract We report the development of a new real-time polymerase chain reaction (PCR) detection system that uses oligonucleotide "tagged" PCR primers, a fluorophore-labeled "universal" detection oligonucleotides, and a complementary quenching oligonucleotide. The fluorescence signal decreases as PCR product accumulates due to the increase in detection/quencher hybrid formation as the tagged primer is consumed. We use plasmids containing the influenza A matrix gene and the porA and ctrA genes of Neisseria meningitidis as targets for developing the system. Cycle threshold (C(t)) values were generated, and the sensitivity of the new system (dubbed "PrimRglo") compared favorably with the commonly used SYBR green and Taqman detection systems and, unlike the latter system, does not require the design of ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5637075 Wed, 04 Jan 2012 05:00:00 +0100 5637075 http://www.medworm.com/index.php?rid=5637074&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22266294%26dopt%3DAbstract Authors: Lu SY, Lin C, Li YS, Zhou Y, Meng XM, Yu SY, Li ZH, Li L, Ren HL, Liu ZS Abstract A lateral flow immunochromatographic (LFIC) test strip based on a colloidal gold-monoclonal antibody (McAb) conjugate was developed for on-site rapid detection of okadaic acid (OA) in shellfish. It applies a competitive format using an immobilized toxin conjugate and free toxin present in samples. The McAb against OA was conjugated with 20-nm colloidal gold as detector reagent. The toxin in the sample competed with the immobilized toxin to bind to the gold conjugated with McAb. The colloidal gold/McAb/toxin mobile complex was not captured by OA-bovine serum albumin (BSA) on the test line, but it was captured by goat anti-mouse immunoglobulin G (IgG) on the control line. The color density of t... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5637074 Wed, 04 Jan 2012 05:00:00 +0100 5637074 http://www.medworm.com/index.php?rid=5637069&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22274538%26dopt%3DAbstract Authors: Stamova S, Feldmann A, Cartellieri M, Arndt C, Koristka S, Apel F, Wehner R, Schmitz M, Bornhäuser M, von Bonin M, Ehninger G, Bartsch H, Bachmann M Abstract There is growing interest in the development of novel single-chain bispecific antibodies for retargeting of immune effector T cells to tumor cells. Until today, functional fusion constructs consisting of a single-chain bispecific antibody and a fluorescent protein were not reported. Such molecules could be useful for an in vivo visualization of this retargeting process. Recently, we established two novel single-chain bispecific antibodies. One is capable of retargeting T cells to CD33, and the other is capable of retargeting T cells to the prostate stem cell antigen (PSCA). CD33 is an attractive immunotarget on the s... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5637069 Wed, 04 Jan 2012 05:00:00 +0100 5637069 http://www.medworm.com/index.php?rid=5637077&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22266209%26dopt%3DAbstract In this study, blood was collected from 5 male subjects (three times). Clot formation was initiated in whole blood with 5pM Tf in the presence of CTI, and fibrinolysis was induced by adding tissue plasminogen activator (tPA). Changes in viscoelasticity were then monitored by TEG. In quality control assays, our Tf reagent, when used at 5pM, induced coagulation in whole blood in 3.93±0.23min and in plasma in 5.12±0.23min (n=3). In TEG assays, tPA significantly decreased clot strength (maximum amplitude, MA) in all individuals but had no effect on clot time (R time). The intraassay variability (CVa<10%) for R time, angle, and MA suggests that these parameters reliably describe the dynamics of fibrin formation and degradation in whole blood. Our Tf reagent reproducibly induces coagulation... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5637077 Tue, 03 Jan 2012 05:00:00 +0100 5637077 http://www.medworm.com/index.php?rid=5637070&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22266300%26dopt%3DAbstract Authors: Nagel R, Gershenzon J, Schmidt A Abstract Terpenoids form the largest class of plant metabolites involved in primary and secondary metabolism. Isoprenyl diphosphate synthases (IDSs) catalyze the condensation of the C(5) terpenoid building blocks, isopentenyl diphosphate and dimethylallyl diphosphate, to form geranyl diphosphate (C(10)), farnesyl diphosphate (C(15)), and geranylgeranyl diphosphate (C(20)). These branch point reactions control the flow of metabolites that act as precursors to each of the major terpene classes-monoterpenes, sequiterpenes, and diterpenes, respectively. Thus accurate and easily performed assays of IDS enzyme activity are critical to increase our knowledge about the regulation of terpene biosynthesis. Here we describe a new and sensitive nonradi... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5637070 Tue, 03 Jan 2012 05:00:00 +0100 5637070 http://www.medworm.com/index.php?rid=5637080&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22266206%26dopt%3DAbstract We describe and demonstrate here an approach of using a silicone sheet with holes, conveniently cut out precisely using an inexpensive cutting plotter to correspond with regions where liquid is to be dispensed, and attaching it to a transparency to create very thin well arrays. With this, the contact angle hysteresis behavior of liquid could be harnessed to produce taller drop shapes so that the fiber probe used could read in the emitted light more effectively. Experimentation conducted revealed fluorescence measurements that were significantly more sensitive than standard microplates, notwithstanding that smaller volumes of liquid were needed. This was achieved using both the fiber optic and imaging evaluation modes. The two methods investigated, one with a lid placed and one without, sho... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5637080 Mon, 02 Jan 2012 05:00:00 +0100 5637080 http://www.medworm.com/index.php?rid=5507169&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22125142%26dopt%3DAbstract Authors: Gogichaeva NV, Alterman MA Abstract Here, we describe two different amino acid analysis protocols based on the application of matrix-assisted laser desorption ionization time-of-flight (MALDI TOF) mass spectrometry (MS). First protocol describes a MALDI TOF MS-based method for a routine simultaneous qualitative and quantitative analysis of free amino acids and protein hydrolysates (Alterman et al. Anal Biochem 335: 184-191, 2004). Linear responses between the amino acid concentration and the peak intensity ratio of corresponding amino acid to internal standard were observed for all amino acids analyzed in the range of concentrations from 20 to 300 μM. Limit of quantitation varied from 0.03 μM for arginine to 3.7 μM for histidine and homocysteine. This method has one inh... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5507169 Fri, 16 Dec 2011 16:42:12 +0100 5507169 http://www.medworm.com/index.php?rid=5273685&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21864497%26dopt%3DAbstract We describe a simple method for real-time monitoring of matrix metalloproteinase-9 (MMP-9) collagenolytic activity for native triple helical collagen IV with a surface plasmon resonance (SPR) biosensor. The proteolytic activity of MMP-9 is measured as a decrease in the SPR signal resulting from the cleavage of collagen IV immobilized on the sensor surface. The kinetic parameters of full-length MMP-9 and its catalytic domain-catalytic constant (k(cat)), association rate constant (k(a)), and dissociation rate constant (k(d))-were estimated by the SPR method. The presence of sodium chloride and a nonionic detergent Brij-35 in a reaction solution led to the lower collagenolytic activity of MMP-9, whereas they suppressed the nonspecific interaction between MMP-9 and a cysteamine-modified chip. ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5273685 Mon, 03 Oct 2011 02:07:57 +0100 5273685 http://www.medworm.com/index.php?rid=5273684&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21871432%26dopt%3DAbstract Authors: Leipold MD, Ornatsky O, Baranov V, Whitfield C, Nitz M Abstract Fluorescent flow cytometry has become the method of choice for interrogation of bacterial populations at the single-cell level. However, limitations of this technique include issues of dynamic range, spectral overlap, photobleaching, and overall low signal intensity due to the small size of bacteria. The recent development of mass cytometry allows single-cell analysis with the resolution of inductively coupled plasma mass spectrometry, facilitating multiparametric analysis. Using a combination of a metal-based membrane stain and lectins conjugated to lanthanide-chelating polymers, we demonstrate that individual Escherichia coli cells can be differentiated based on their cell surface polysaccharides using mass ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5273684 Mon, 03 Oct 2011 02:07:03 +0100 5273684 http://www.medworm.com/index.php?rid=5273683&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21872566%26dopt%3DAbstract Authors: Nelson TJ Abstract A new ultrasensitive fluorescent derivatization procedure for chromatographic analysis of primary, secondary, and nonpolar tertiary alcohols is described. The procedure uses Bodipy FL in basic dichloromethane solution with Mukaiyama's reagent (2-chloro-1-methylpyridinium iodide) to form highly fluorescent ester derivatives that can be separated by silica normal-phase high-performance liquid chromatography (HPLC). Rhodamine WT and Oregon green 488 were also useful derivatization reagents. The detection limit for detection of cholesterol and bryostatin by Bodipy FL was less than 1fmol. The reaction conditions are gentle enough that low concentrations of unstable alcohols such as bryostatin 1 can be measured. PMID: 21872566 [PubMed - as supplied by publ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5273683 Mon, 03 Oct 2011 02:06:43 +0100 5273683 http://www.medworm.com/index.php?rid=5273681&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21945353%26dopt%3DAbstract Authors: Kaplan G, Gershoni JM Abstract The foreign insert intended to be displayed via recombinant phage proteins can have a negative effect on protein expression and phage assembly. A typical example is the case of display of peptides longer than 6 amino acid residues on the major coat protein, protein VIII of the filamentous bacteriophages M13 and fd. A solution to this problem has been the use of "two-gene systems" generating chimeric phages that concomitantly express wild-type protein VIII along with recombinant protein VIII. Although the two-gene systems are much more permissive in regard to insert length and composition, some cases can still adversely affect phage assembly. Although these phages genotypically contain the desired DNA of the insert, they appear to be phenotypi... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5273681 Thu, 08 Sep 2011 04:00:00 +0100 5273681 http://www.medworm.com/index.php?rid=5273680&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21945965%26dopt%3DAbstract Authors: Mehand MS, Srinivasan B, Crescenzo GD Abstract Surface plasmon resonance-based biosensors have been applied to the determination of macromolecule concentration. Up to now, the proposed experimental approaches have relied either on the generation of a calibration curve that exploits only a few data points from each sensorgram or on multiple injections of the unknown sample at various flow rates. In this article, we show that prior knowledge of the kinetic parameters related to the interaction of the species with a given partner could advantageously reduce the number of injections required by both aforementioned methods, thereby reducing experimental time while maintaining a good level of confidence on the determined concentrations. PMID: 21945965 [PubMed - as supplied b... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5273680 Thu, 08 Sep 2011 04:00:00 +0100 5273680 http://www.medworm.com/index.php?rid=5273679&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21945966%26dopt%3DAbstract Authors: Martens-Lobenhoffer J, Rodionov RN, Drust A, Bode-Böger SM Abstract Nitric oxide is an ubiquitary cell signaling substance. Its enzymatic production rate by nitric oxide synthase is regulated by the concentrations of the substrate l-arginine and the competitive inhibitor asymmetric dimethylarginine (ADMA). A newly recognized elimination pathway for ADMA is the transamination to α-keto-δ-(N(G),N(G)-dimethylguanidino)valeric acid (DMGV) by the enzyme alanine-glyoxylate aminotransferase 2 (AGXT2). This pathway has been proven to be relevant for nitric oxide regulation, but up to now no method exists for the determination of DMGV in biological fluids. We have developed a liquid chromatography-tandem mass spectrometry (LC-MS/MS) method for the quantification of DMGV. D(6)-DM... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5273679 Thu, 08 Sep 2011 04:00:00 +0100 5273679 http://www.medworm.com/index.php?rid=5273678&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21951781%26dopt%3DAbstract Authors: Talmont F, Mollereau C, Zajac JM Abstract Functional and structural studies on G-protein-coupled receptors (GPCRs) at molecular levels require producing and purifying high levels of receptors, and recombinant mammalian cell expression systems constitute the best systems to obtain receptors resembling those expressed in natural environments. In the course of increasing GPCR expression in Chinese hamster ovary (CHO) cells, we have expressed mu (μ)- and kappa (κ)-opioid receptors and neuropeptide FF(1) and FF(2) receptors (NPFF(1) and NPFF(2), respectively) in dimethyl sulfoxide. This treatment did not modify the affinity (K(d)) for any receptor, but a significant increase in functional expression levels was observed for all receptors with the noticeable exception of NPFF(1... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5273678 Thu, 08 Sep 2011 04:00:00 +0100 5273678 http://www.medworm.com/index.php?rid=5273677&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21951782%26dopt%3DAbstract Authors: Jiang C, Xu S, Zhang S, Jia L Abstract The high quality of DNA template is one of the key factors to ensure the successful execution of polymerase chain reaction (PCR). Therefore, development of DNA extraction methods is very important. In this work, chitosan modified magnetic particles (MPs) were synthesized and employed for extraction of genomic DNA from genetically modified (GM) soybeans. The extraction protocol used aqueous buffers for DNA binding to and releasing from the surface of the MPs based on the pH inducing the charge switch of amino groups in chitosan modified MPs. The extracted DNA was pure enough (A(260)/A(280)=1.85) to be directly used as templates for PCR amplification. In addition, the PCR products were separated by capillary electrophoresis for screenin... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5273677 Thu, 08 Sep 2011 04:00:00 +0100 5273677 http://www.medworm.com/index.php?rid=5273676&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21951783%26dopt%3DAbstract Authors: Cheng CH, Yang CA, Liu SY, Lo CT, Peng KC Abstract As opposed to single-cell yeast and mammalian cell lines, apoptosis has not been greatly investigated in filamentous fungi because antibodies to the relevant fungal apoptosis-related proteins are not available commercially and because multicellular organisms cannot be studied using flow cytometry. Here we demonstrate how antibodies from a nonfungal source could be used to investigate this pathway. We show that apoptosis in the filamentous fungus Botrytis cinerea is triggered by the mitochondria-mediated caspase pathway, with release of the apoptotic factors cytochrome c, caspase 3, and caspase 9, on treatment with Trichoderma harzianum-derived l-amino acid oxidase. PMID: 21951783 [PubMed - as supplied by publisher] (So... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5273676 Wed, 07 Sep 2011 04:00:00 +0100 5273676 http://www.medworm.com/index.php?rid=5273675&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21951784%26dopt%3DAbstract Authors: Nakazawa S, Hashii N, Harazono A, Kawasaki N Abstract Insulin analog products for subcutaneous injection are prepared as solutions in which insulin analog molecules exist in several oligomeric states. Oligomeric stability can affect their onset and duration of action and has been exploited in designing them. To investigate the oligomeric stability of insulin analog products having different pharmacokinetics, we performed hydrogen/deuterium exchange mass spectrometry (HDX/MS), which is a rapid method to analyze dynamic aspects of protein structures. Two rapid-acting analogs (lispro and glulisine) incorporated deuteriums more and faster than recombinant human insulin, whereas a long-acting analog (glargine) and two intermediate-acting preparations (protamine-containing formu... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5273675 Wed, 07 Sep 2011 04:00:00 +0100 5273675 http://www.medworm.com/index.php?rid=5273682&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21945352%26dopt%3DAbstract Authors: Faúndez M, Rojas M, Bohle P, Reyes C, Letelier ME, Aliaga ME, Speisky H, Lissi E, López-Alarcón C Abstract The bleaching of the pyrogallol red (PGR) dye mediated by superoxide anion radicals (O(2)(-)) generated from the xanthine/xanthine oxidase system (X/XO) was studied by UV-visible spectrophotometry. The absorption band (at 540nm) of PGR quickly decreased in the presence of X/XO, implying an efficient reaction of O(2)(-) with PGR. The process was unaffected by catalase (CAT), but completely abolished by superoxide dismutase (SOD). A mechanism of the reaction involving the consumption of one PGR molecule by two O(2)(-) to generate one molecule of H(2)O(2) is proposed. PGR was used as a probe to estimate the rate of O(2)(-) generation in redox cycling reactions of a se... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5273682 Thu, 01 Sep 2011 04:00:00 +0100 5273682 http://www.medworm.com/index.php?rid=5241436&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21925476%26dopt%3DAbstract In conclusion, the validation results demonstrate that this method is robust and specific. This validated method is a novel technique for sample preparation and quantitation and was successfully applied to estimate the pharmacokinetics of triterpenoidal saponins. PMID: 21925476 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5241436 Thu, 01 Sep 2011 04:00:00 +0100 5241436 http://www.medworm.com/index.php?rid=5241438&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21925474%26dopt%3DAbstract Authors: Igarashi F, Hikiba J, Ogihara MH, Nakaoka T, Suzuki M, Kataoka H Abstract The biochemical quantification of sterols in insects has been difficult because only small amounts of tissues can be obtained from insect bodies and because sterol metabolites are structurally related. We have developed a highly specific and sensitive quantitative method for determining of the concentrations of seven sterols-7-dehydrocholesterol, desmosterol, cholesterol, ergosterol, campesterol, stigmasterol, and β-sitosterol-using a high performance liquid chromatography-atmospheric pressure chemical ionization-tandem mass spectrometry (HPLC/APCI-MS/MS). The sterols were extracted from silkworm larval tissues using the Bligh and Dyer method and were analyzed using HPLC/APCI-MS/MS with selected rea... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5241438 Wed, 31 Aug 2011 04:00:00 +0100 5241438 http://www.medworm.com/index.php?rid=5241434&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21925480%26dopt%3DAbstract Authors: Xu L, Lv J, Lin L, Wang P, Song P, Su R, Zhu G Abstract Nucleic acids were found to partition into the phenol phase during phenol extraction in the presence of guanidinium at certain concentrations under acidic conditions. The guanidinium-concentration-dependent nucleic acid partitioning patterns were analogous to those of the nucleic acid adsorption/partitioning onto silica mediated by guanidinium, which implied that phenol and silica interact with nucleic acids through similar mechanisms. A competition effect was observed in which the nucleic acids that had partitioned into the phenol phase or onto the silica solid phase could be recovered to the aqueous phases by potassium in a molecular weight-salt concentration-dependent manner (the higher molecular weight nucleic aci... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5241434 Wed, 31 Aug 2011 04:00:00 +0100 5241434 http://www.medworm.com/index.php?rid=5241428&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21933659%26dopt%3DAbstract Authors: Baird CL, Tan R, Fischer CJ, Victry KD, Zangar RC, Rodland KD Abstract Sandwich enzyme-linked immunosorbent assay (ELISA) microarrays can simultaneously quantify the levels of multiple diagnostic targets in a biological sample. However, as with traditional ELISA diagnostics, endogenous antibodies in patient sera can cause interference. We demonstrate here that reducing the diagnostic capture antibody to its minimal functional unit (i.e., a single-chain antibody fragment [scFv]) is an effective strategy for reducing assay interference. Our finding illustrates a source of error introduced by the reliance on immunoglobulin-based capture reagents in sandwich immunoassays with human serum samples. We demonstrate that scFvs can be used in such assays to improve reliability by re... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5241428 Tue, 30 Aug 2011 04:00:00 +0100 5241428 http://www.medworm.com/index.php?rid=5241430&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21933657%26dopt%3DAbstract Authors: Dixson DD, Yu VY, Doyle RP Abstract The use of coenzyme Q10 (CoQ10) has been increasing rapidly during recent years due to its postulated beneficial properties in human health, providing energy and antioxidant protection. There are no known negative side effects of CoQ10 even at very high levels. Recently, native saposin B (sapB) has been shown to bind CoQ10 and subsequently be excreted. It is thought that this interaction between sapB and CoQ10 could be a mechanism to avoid any possible CoQ10 toxicity. The interaction between sapB and CoQ10 is poorly understood. Here we present an increased fermentative yield of recombinant sapB and demonstrate that recombinant sapB will bind CoQ10 in a pH-dependent manner similar to sapB binding with other lipids. SapB was coated onto an... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5241430 Sun, 28 Aug 2011 04:00:00 +0100 5241430 http://www.medworm.com/index.php?rid=5241437&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21925475%26dopt%3DAbstract Authors: Zhu A, Romero R, Petty HR Abstract A specific colorimetric assay for the determination of glucose-6-phosphate (G6P) was developed. This assay is based on the oxidation of G6P in the presence of glucose-6-phosphate dehydrogenase (G6PD) and nicotinamide adenine dinucleotide phosphate (NADP(+)); the NADPH thereby generated reduces the tetrazolium salt WST-1 [2-(4-indophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H tetrazolium, monosodium salt] to water-soluble yellow-colored formazan with 1-methoxy-5-methylphenazium methylsulfate (1-mPMS) as an electron carrier. The assay is optimized for reaction buffer pH, enzyme/dye concentration, and reaction time course. The limit of detection of the assay is 0.15μM (15pmol/well). The usefulness of the assay is demonstrated by the ac... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5241437 Sat, 27 Aug 2011 04:00:00 +0100 5241437 http://www.medworm.com/index.php?rid=5241435&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21925477%26dopt%3DAbstract Authors: von Kanel T, Gerber D, Wittwer CT, Hermann M, Gallati S Abstract Real-time quantitative polymerase chain reaction (qPCR) depends on precise temperature control of the sample during cycling. In the current study, we investigated how temperature variation in plate-based qPCR instruments influences qPCR results. Temperature variation was measured by amplicon melting analysis as a convenient means to assess well-to-well differences. Multiple technical replicates of several SYBR Green I-based qPCR assays allowed correlation of relative well temperature to quantification cycle. We found that inadequate template denaturation results in an inverse correlation and requires increasing the denaturation temperature, adding a DNA destabilizing agent, or pretreating with a restriction e... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5241435 Sat, 27 Aug 2011 04:00:00 +0100 5241435 http://www.medworm.com/index.php?rid=5241429&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21933658%26dopt%3DAbstract Authors: Kijewska M, Stefanowicz P, Kluczyk A, Szewczuk Z Abstract A nonenzymatic reaction of reducing sugars with the free amino group located at the N terminus of the polypeptide chain or in the lysine side chain results in glycation of proteins. The fragments of glycated proteins obtained by enzymatic hydrolysis could be considered as the biomarkers of both the aging process and diabetes mellitus. Here we propose a new method for the identification of peptide-derived Amadori products in the enzymatic digest of glycated proteins. The products of enzymatic hydrolysis of the model protein ubiquitin were incubated with H(2)(18)O under microwave activation. We observed that at these conditions the Amadori compounds selectively exchange one oxygen atom in the hexose moiety. The charac... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5241429 Sat, 27 Aug 2011 04:00:00 +0100 5241429 http://www.medworm.com/index.php?rid=5241433&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21925481%26dopt%3DAbstract Authors: Krishnan S, Collazo E, Ortiz-Tello PA, Trievel RC Abstract The Jumonji C (JmjC) lysine demethylases (KDMs) are Fe(II)-dependent hydroxylases that catalyze the oxidative demethylation of methyllysine residues in histones and nonhistone proteins. These enzymes play vital roles in regulating cellular processes such as gene expression, cell cycle progression, and stem cell self-renewal and differentiation. Despite their biological importance, recombinant forms of JmjC KDMs generally display low enzymatic activity and have remained challenging to isolate in a highly active form. Here we present a simple affinity purification scheme for Strep(II)-tagged JmjC KDMs that minimizes contamination by transition state metal ions, yielding highly pure and active enzyme. We also describe... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5241433 Fri, 26 Aug 2011 04:00:00 +0100 5241433 http://www.medworm.com/index.php?rid=5241432&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21925482%26dopt%3DAbstract We report the development of a fluorescence polarization (FP) assay for PBPs and "serine" β-lactamases using a boronic-acid-based, reversibly binding "tracer." The tracer was designed based on a crystal structure of a covalent complex between a boronic acid and PBP1b from Streptococcus pneumoniae. The tracer bound to three different PBPs with modest affinity (K(d)=4-12μM) and more tightly to the TEM1 serine β-lactamase (K(d)=109nM). β-Lactams and other boronic acids were able to displace the tracer in competition assays. These results indicate that fluorescent boronic acids are highly suited to serve as reversibly binding tracers in FP-based assays with PBPs and β-lactamases and potentially with other related enzymes. PMID: 21925482 [PubMed - as supplied by publisher] (Source: Ana... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5241432 Fri, 26 Aug 2011 04:00:00 +0100 5241432 http://www.medworm.com/index.php?rid=5241431&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21925483%26dopt%3DAbstract Authors: Tsuchiya A, Asai D, Kang JH, Mori T, Niidome T, Katayama Y Abstract To investigate the correlation between the counts per minute (CPM) by radioactivity assay and the phosphorylation ratio by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) analysis, we prepared 136 peptide substrates. The correlation coefficient of phosphorylation ratios to CPM was 0.77 for all samples. However, the more the numbers of positively charged amino acids increased, the more the correlation coefficient increased. Although positively charged amino acids can have an effect on the correlation results, MALDI-TOF MS analysis is a useful means for monitoring phosphorylated peptide and protein kinase activity instead of radioactivity assays. PMID: 21925483... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5241431 Fri, 26 Aug 2011 04:00:00 +0100 5241431 http://www.medworm.com/index.php?rid=5225863&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21910959%26dopt%3DAbstract Authors: Korn M, Frank O, Hofmann T, Rychlik M Abstract Two new stable isotope dilution assays were developed for the quantification of ochratoxin A in human blood samples for exposure studies. The methods based on two different sample extraction and cleanup procedures including liquid-liquid extraction with following immunoaffinity chromatography (IA) as well as a dispersive solid-phase extraction (DSPE) method. For detection, LC-MS/MS was applied. For the first time, exact quantitation of the reference compound ochratoxin A was performed by quantitative NMR spectroscopy (qNMR). Additionally, a comparison of different blood-drawing procedures revealed no differences for heparin plasma and serum whereas citrate plasma gave significantly lower results for the mycotoxin. Limits of de... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5225863 Fri, 26 Aug 2011 04:00:00 +0100 5225863 http://www.medworm.com/index.php?rid=5225862&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21910961%26dopt%3DAbstract Authors: Yu HP, Hsiao YL, Pan HY, Huang CH, Hou SY Abstract A rapid quantification method for micro-RNA based on DNA polymerase activity and pyrophosphate quantification has been developed. The tested micro-RNA serves as the primer, unlike the DNA primer in all DNA sequencing methods, and the DNA probe serves as the template for DNA replication. After the DNA synthesis, the pyrophosphate detection and quantification indicate the existence and quantity of the tested miRNA. Five femtomoles of the synthetic RNA could be detected. In 20-100μg RNA samples purified from SiHa cells, the measurement was done using the proposed assay in which hsa-miR-16 and hsa-miR-21 are 0.34fmol/μg RNA and 0.71fmol/μg RNA, respectively. This simple and inexpensive assay takes less than 5min after total... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5225862 Fri, 26 Aug 2011 04:00:00 +0100 5225862 http://www.medworm.com/index.php?rid=5225861&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21910962%26dopt%3DAbstract Authors: Niklas J, Hollemeyer K, Heinzle E Abstract A high-throughput method is described for quantitative analysis of phospholipids. The method comprises extraction of lipids, addition of the internal standard N-trifluoroacetyl-phosphatidylethanolamine, and final analysis using matrix-assisted laser desorption ionization mass spectrometry. Quantitative data are obtained by calibration directly in the sample matrix. Calibration with one phosphatidylcholine was found sufficient for quantification of all major phosphatidylcholines tested. The method is very sensitive, has broad application, and is easily applicable to any biological sample. The detection limit for phosphatidylcholines was clearly below 2μg on the spot, requiring less than 4000 cells corresponding to about 1.6μg cel... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5225861 Wed, 24 Aug 2011 04:00:00 +0100 5225861 http://www.medworm.com/index.php?rid=5225860&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21910963%26dopt%3DAbstract Authors: Beets C, Dubery I Abstract Camalexin is a phytoalexin of Arabidopsis thaliana and an important component of inducible defenses. Accurate quantification of low concentrations suffers from interference by structurally related metabolites. A. thaliana plants were induced with silver nitrate and camalexin was extracted using methanol and identified and quantified by (i) TLC as a blue fluorescent band, (ii) microtiter plate-based fluorescence spectroscopy, (iii) GC on a midpolar column coupled to flame ionization detection, (iv) C(18) HPLC coupled to a photodiode detector, and (v) UPLC coupled to a mass spectrometer detector. Standard curves over the range of 0.1-15μgml(-1) gave R(2) values from 0.996 to 0.999. The different methods were compared and evaluated for their abilit... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5225860 Wed, 24 Aug 2011 04:00:00 +0100 5225860 http://www.medworm.com/index.php?rid=5215876&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21907698%26dopt%3DAbstract We describe here a novel method of surface plasmon resonance (SPR) based on multisequential analysis with SNA-1, AAL, and PHA-L(4) lectin, to estimate the glycosylation status of haptoglobin in sera of patients with prostate cancer (n=15), benign prostate disease (BPD) including benign prostatic hypertrophy (n=20), and normal subjects (n=11). The SPR-based analysis involves the use of anti-haptoglobin as ligand and dilution of the analyte to 1400-fold and filtration, followed by detection of the sugar chain by lectin solution. The normalized RU of lectin to haptoglobin represents the binding amount of lectin divided by that of haptoglobin. The normalized RU by SNA-1 of the prostate cancer group was significantly higher than those of the control and BPD group. SNA-1 detected NeuAcα2,6 in a... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5215876 Tue, 23 Aug 2011 04:00:00 +0100 5215876 http://www.medworm.com/index.php?rid=5215874&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21907700%26dopt%3DAbstract Authors: Ferguson ML, Le Coq D, Jules M, Aymerich S, Declerck N, Royer CA Abstract Quantification of promoter activity or protein expression in gene regulatory networks is generally achieved via measurement of fluorescent protein (FP) intensity, which is related to the true FP concentration by an unknown scaling factor, thereby limiting analysis and interpretation. Here, using approaches originally developed for eukaryotic cells, we show that two-photon (2p) fluorescence fluctuation microscopy, specifically scanning number and brightness (sN&B) analysis, can be applied to determine the absolute concentrations of diffusing FPs in live bacterial cells. First, we demonstrate the validity of the approach, despite the small size of the bacteria, using the central pixels and spatial ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5215874 Mon, 22 Aug 2011 04:00:00 +0100 5215874 http://www.medworm.com/index.php?rid=5215881&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21889485%26dopt%3DAbstract Authors: Nakabayashi T, Takakusagi Y, Iwabata K, Sakaguchi K Abstract A foam fractionation apparatus was prepared to aid protein separation at the gas-liquid interface. Using lysozyme as a model protein, we investigated the alteration of enzymatic and optical activities through foaming. The lysozyme transferred to the gaseous nitrogen phase after 5min of bubbling with no exogenous detergent. The bacteriolytic and optical activities of lysozyme from the foamate were nearly equivalent to those of the original lysozyme. This result indicated that lysozyme did not irreversibly denature during foam fractionation. We then performed protein separation using binary mixtures of lysozyme and α-amylase. When the two proteins were dissolved in bulk solution of pH 10.5, which is close to the i... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5215881 Thu, 18 Aug 2011 04:00:00 +0100 5215881 http://www.medworm.com/index.php?rid=5215879&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21893022%26dopt%3DAbstract Authors: Morrison KC, Hergenrother PJ Abstract Perturbation of the tubulin/microtubule dynamic in cells is perhaps the single most important mode of action of anticancer drugs. Standard methods for identifying and evaluating compounds for their ability to alter tubulin polymerization are low throughput, labor intensive, and expensive or make their assessment in vitro. Here we report a method to rapidly quantify the extent of tubulin polymerization in whole cells using flow cytometry, and we use this technique to evaluate compounds that stabilize and destabilize microtubule formation. This facile method is useful for conveniently, quantitatively, and cost-effectively comparing small molecules that perturb tubulin polymerization. PMID: 21893022 [PubMed - as supplied by publisher]... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5215879 Thu, 18 Aug 2011 04:00:00 +0100 5215879 http://www.medworm.com/index.php?rid=5215877&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21907697%26dopt%3DAbstract Authors: Lim G, Hwang HJ, Kim JH Abstract A new efficient immobilization method that enables oriented immobilization of biologically active proteins was developed based on concepts of active site masking and kinetic control. Taq DNA polymerase was immobilized covalently on mixed self-assembled monolayers (SAMs) of ω-carboxylated thiol and ω-hydroxylated thiol through amide bonds between the protein and the carboxyl group in SAMs. Activity of the immobilized enzyme as large as 70% of solution-phase enzyme was achieved by masking the active site of the Taq DNA polymerase prior to the immobilization. In addition, the number of immobilization bonds was controlled by optimizing the carboxyl group concentration in the mixed monolayer. The maximum activity of immobilized Taq DNA polymer... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5215877 Thu, 18 Aug 2011 04:00:00 +0100 5215877 http://www.medworm.com/index.php?rid=5215875&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21907699%26dopt%3DAbstract Authors: Collins JM, Nettikadan S Abstract Tip-based direct protein printing is a relatively new technique that is useful for controlling the cellular microenvironment with subcellular resolution. Coculture studies have been useful for mimicking the in vivo environment and studying effects on stem or progenitor cell function. However, there are many experimental variables that cannot be properly controlled and may lead to confounding results. Here we demonstrate a technique that allows spatial control of multiple cell types at single cell levels on a substrate. Specifically, 3T3 fibroblasts and C2C12 myoblasts and their respective binding dynamics with fibronectin and laminin demonstrate the single cell coculture concept. PMID: 21907699 [PubMed - as supplied by publisher] (Sour... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5215875 Thu, 18 Aug 2011 04:00:00 +0100 5215875 http://www.medworm.com/index.php?rid=5215886&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21888890%26dopt%3DAbstract Authors: Kim JS, Shin M, Song JS, An S, Kim HJ Abstract Due to almost identical chemical properties of C-terminal and side-chain carboxylic groups, selective C-terminal derivatization has been difficult. Although oxazolone-based C-terminal derivatization is the only selective C-terminal modification available, it has not been used widely because of its low derivatization efficiency. In this paper, an improved oxazolone chemistry for incorporation of Br signature to C-terminus is reported. MS/MS analysis of the brominated peptides led to a series of y ions with Br signature, facilitating de novo C-terminal sequencing. PMID: 21888890 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5215886 Tue, 16 Aug 2011 04:00:00 +0100 5215886 http://www.medworm.com/index.php?rid=5215885&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21888891%26dopt%3DAbstract Authors: Upadhaya R, Mizunoya W, Anderson JE Abstract Western blot detection of multiple proteins is challenged by antibodies from the same species and the use of harsh stripping methods that can remove protein or reduce protein antigenicity. Quenching using 27% hydrogen peroxide was developed as an alternative to stripping to inhibit horseradish peroxidase used to detect secondary antibodies. To detect two epitopes with same-species primary antibodies, quenching was followed by incubation in a precomplexed mixture of primary and secondary antibodies for the second epitope plus serum from that species. Both methods will be valuable in specific detection of multiple proteins by Western blotting, and will save time, valuable samples, and reagents. PMID: 21888891 [PubMed - as supp... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5215885 Tue, 16 Aug 2011 04:00:00 +0100 5215885 http://www.medworm.com/index.php?rid=5215884&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21889482%26dopt%3DAbstract DNA melting analysis: Application of the "open tube" format for detection of mutant KRAS. Anal Biochem. 2011 Aug 16; Authors: Botezatu IV, Kondratova VN, Shelepov VP, Lichtenstein AV Abstract High-resolution melting (HRM) analysis is a very effective method for genotyping and mutation scanning that is usually performed just after PCR amplification (the "closed tube" format). Though simple and convenient, the closed tube format makes the HRM dependent on the PCR mix, not generally optimal for DNA melting analysis. Here, the "open tube" format, namely the post-PCR optimization procedure (amplicon shortening and solution chemistry modification), is proposed. As a result, mutation scanning of short amplicons becomes feasible on a standard real-time PCR instrument (not primarily... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5215884 Tue, 16 Aug 2011 04:00:00 +0100 5215884 http://www.medworm.com/index.php?rid=5215883&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21889483%26dopt%3DAbstract Authors: Sendler E, Johnson GD, Krawetz SA Abstract High-throughput RNA sequencing (RNA-seq) continues to provide unparalleled insight into transcriptome complexity. Now the "gold standard" for assessing global transcript levels, RNA-seq is poised to revolutionize our understanding of transcription and posttranscriptional regulation of RNA. Despite significant advantages over prior experimental strategies, RNA-seq is not without pitfalls. We have identified a number of confounding factors that significantly affect sequencing coverage. These include regional GC content, preferential sites of fragmentation, and read "pile-up" due to primer affinity and transcript end effects. Independent of cell type and laboratory, when ignored, these factors can bias analyses. Understanding the und... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5215883 Tue, 16 Aug 2011 04:00:00 +0100 5215883 http://www.medworm.com/index.php?rid=5215882&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21889484%26dopt%3DAbstract Authors: Die JV, Obrero A, González-Verdejo CI, Román B Abstract Determination of RNA quality is a critical first step in obtaining meaningful gene expression data. The PCR-based 3':5' assay is an RNA quality assessment tool. This assay is a simple, fast, and low-cost method of selecting samples for further analysis. However, its practical applications are unexploited primarily because of the absence of an experimental threshold. We show that, by anchoring the 5' assay a specific distance from the 3' end of the sequence and by spacing the 3' at a distance of a number of nucleotides, a cutoff determines whether a sample is suitable for downstream quantification studies. PMID: 21889484 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5215882 Tue, 16 Aug 2011 04:00:00 +0100 5215882 http://www.medworm.com/index.php?rid=5215880&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21889486%26dopt%3DAbstract We report the characterization of a 96-well format assay to monitor d-serine in plasma that greatly expedites analysis time. The assay involves the use of strong cation exchange solid phase extraction (SPE) to isolate d-serine from plasma followed by quantitation of d-serine using the DAAO-catalyzed reaction. Plasma d-serine determination using this assay could also be used as pharmacodynamic marker and as biomarker. PMID: 21889486 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5215880 Tue, 16 Aug 2011 04:00:00 +0100 5215880 http://www.medworm.com/index.php?rid=5215878&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21893023%26dopt%3DAbstract Authors: Poras H, Ouimet T, Orng SV, Dangé E, Fournié-Zaluski MC, Roques BP Abstract Protease inhibitors represent a major class of drugs, even though a large number of proteases remain unexplored. Consequently, a great interest lies in the identification of highly sensitive substrates useful for both the characterization and the validation of these enzyme targets and for the design of inhibitors as potential therapeutic agents through high-throughput screening (HTS). With this aim, a synthetic substrate library, in which the highly fluorescent (L)-pyrenylalanine residue (Pya) is efficiently quenched by its proximity with the p-nitro-(L)-phenylalanine (Nop) moiety, was designed. The cleavage between Pya and Nop leads to a highly fluorescent metabolite providing the required sensi... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5215878 Tue, 16 Aug 2011 04:00:00 +0100 5215878 http://www.medworm.com/index.php?rid=5215888&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21888888%26dopt%3DAbstract Authors: Lame ME, Chambers EE, Blatnik M Abstract Critical events in Alzheimer's disease (AD) involve an imbalance between the production and clearance of amyloid beta (Aβ) peptides from the brain. Current methods for Aβ quantitation rely heavily on immuno-based techniques. However, these assays require highly specific antibodies and reagents that are time-consuming and expensive to develop. Immuno-based assays are also characterized by poor dynamic ranges, cross-reactivity, matrix interferences, and dilution linearity problems. In particular, noncommercial immunoassays are especially subject to high intra- and interassay variability because they are not subject to more stringent manufacturing controls. Combinations of these factors make immunoassays more labor-intensive and ofte... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5215888 Fri, 12 Aug 2011 04:00:00 +0100 5215888 http://www.medworm.com/index.php?rid=5215887&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21888889%26dopt%3DAbstract Authors: Feng LJ, Zhang XH, Liu P, Xiong HY, Wang SF Abstract Poly(sulfosalicylic acid) and single-stranded DNA composite (PSSA-ssDNA)-modified glassy carbon electrode (GCE) was prepared by electropolymerization and then successfully used to simultaneously determine adenine (A), guanine (G), and thymine (T). The characterization of electrochemically synthesized PSSA-ssDNA film was investigated by scanning electron microscopy (SEM) and electrochemical impedance spectroscopy (EIS). The modified electrode exhibited enhanced electrocatalytic behavior and good stability for the simultaneous determination of A, G, and T in 0.1M phosphate buffer solution (PBS, pH 7.0). Well-separated voltammetric peaks were obtained among A, G, and T presented in the analyte mixture. Under the optimal con... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5215887 Fri, 12 Aug 2011 04:00:00 +0100 5215887 http://www.medworm.com/index.php?rid=5189870&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21884677%26dopt%3DAbstract Authors: Wang Y, Ni Y, Kokot S Abstract The interaction of salbutamol (Sal), an animal growth promoter, with DNA was investigated by differential pulse voltammetry (DPV), cyclic voltammetry (CV), and fluorescence spectroscopy. An irreversible reduction was observed from the cyclic voltammograms, and the reaction mechanism involved a one-electron change irreversible oxidation. In the presence of DNA, the DPV peak current decreased and the Sal peak shifted to higher potentials, indicating that Sal interacted with DNA to form an intercalation Sal-DNA complex. In addition, reaction binding parameters were extracted from the DPV data with the use of the multivariate curve resolution-alternating least squares (MCR-ALS) method; the binding constant and ratio were found to be (2.0±0.5)×1... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5189870 Thu, 11 Aug 2011 23:00:00 +0100 5189870 http://www.medworm.com/index.php?rid=5189874&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21871430%26dopt%3DAbstract Authors: Fan H, Zhao K, Lin Y, Wang X, Wu B, Li Q, Cheng L Abstract In this paper, we constructed a new electrochemical biosensor for DNA detection based on a molecule recognition technique. In this sensing protocol, a novel dual-labeled DNA probe (DLP) in a stem-loop structure was employed, which was designed with dabcyl labeled at the 3' end as a guest molecule, and with a Pb nanoparticle labeled at the 5' end as electrochemical tag to indicate hybridization. One α-cyclodextrin-modified electrode (α-CD/MCNT/GCE) was used for capturing the DNA hybridization. Initially, the DLP was in the "closed" state in the absence of the target, which shielded dabcyl from the bulky α-CD/MCNT/GCE conjugate due to a steric effect. After hybridization, the loop sequence (16 bases) formed a rigi... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5189874 Tue, 09 Aug 2011 23:00:00 +0100 5189874 http://www.medworm.com/index.php?rid=5189873&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21871431%26dopt%3DAbstract Authors: Chuang JH, Kao YJ, Ruderman NB, Tung LC, Lin Y Abstract We studied the extraction and analysis of integral membrane proteins possessing hydrophobic and hydrophilic domains and found that a nonionic detergent called MEGA-10, used in lysis buffers, had a superior extraction effect compared to most conventional detergents. A sodium dodecyl sulfate (SDS) concentration of >0.4% (w/v) in the sample buffer was crucial for those proteins to be clearly analyzed by electrophoresis and Western blotting. Furthermore, MEGA-10 had the tendency to maximally extract proteins around its critical micelle concentration (CMC) of 0.24% (w/v). These solutions can greatly assist functional investigations of membrane proteins in the proteomics era. PMID: 21871431 [PubMed - as supplied by p... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5189873 Tue, 09 Aug 2011 23:00:00 +0100 5189873 http://www.medworm.com/index.php?rid=5189872&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21872565%26dopt%3DAbstract Authors: Hurum DC, Rohrer JS Abstract Glycoprotein sialylation analysis is a common analytical step in characterizing biotherapeutic products and expression experiments to optimize production. In this article, a high-throughput (5-min) high-performance anion exchange chromatography with pulsed amperometric detection (HPAE-PAD)-based analytical method for glycoprotein sialic acid determination is described. Results from this method are compared with both published HPAE-PAD and 1,2-diamino-4,5-methylenedioxybenzene (DMB) derivatization followed by ultra high-performance liquid chromatography fluorescence detection (UHPLC-FLD) assays. The quantified sialic acid amounts agree with prior HPAE-PAD analyses within replicate error and with UHPLC-FLD within an average of 24%, which are equi... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5189872 Tue, 09 Aug 2011 23:00:00 +0100 5189872 http://www.medworm.com/index.php?rid=5189871&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21875570%26dopt%3DAbstract In this study, we show that proteins could be selectively induced to form amyloid fibrils at room temperature by the introduction of imidazolium salts, which could trigger the self-assembly process with their hydrophobic and ionic properties. PMID: 21875570 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5189871 Tue, 09 Aug 2011 23:00:00 +0100 5189871 http://www.medworm.com/index.php?rid=5171612&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21867671%26dopt%3DAbstract Differential analysis of "protein corona" profile adsorbed onto different nonviral gene delivery systems. Anal Biochem. 2011 Aug 9; Authors: Capriotti AL, Caracciolo G, Caruso G, Foglia P, Pozzi D, Samperi R, Laganà A Abstract A shotgun proteomics approach was used to characterize and compare the proteins that lead to the formation of a rich "protein corona" adsorbed onto the surfaces of cationic liposomes (CLs), lipoplexes, and lipid/polycation/DNA (LPD) complexes, when they come into contact with plasma. After separation of the nanoparticle-protein complex from plasma, the protein mixture was digested, and peptides were analyzed by nanoliquid chromatography-Orbitrap LTQ-XL mass spectrometry. The number of proteins bound to lipoplexes was double that of those identified i... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5171612 Mon, 08 Aug 2011 23:00:00 +0100 5171612 http://www.medworm.com/index.php?rid=5171611&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21867673%26dopt%3DAbstract Authors: Liu Z, Mouradov A, Smith KF, Spangenberg G Abstract Current methods for measuring fructan levels in plant tissues are time-consuming and costly. They often involve multiple or sequential extractions, enzymatic or acid hydrolysis of fructan polymers, and multiple HPLC runs to quantify fructan-derived hexoses. Here we describe a new method that requires a single extraction step, followed by selective precipitation of fructans by acetone, acid hydrolysis of the precipitate, and a short (10min) HPLC run to complete the procedure. We used perennial ryegrass samples to show that that the new method has similar sensitivity, but better reproducibility, than a more complex method that is widely used. We have used the new method to study developmentally related changes in fructan le... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5171611 Mon, 08 Aug 2011 23:00:00 +0100 5171611 http://www.medworm.com/index.php?rid=5171615&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21864498%26dopt%3DAbstract We present herein a protein chip for diagnosis of sepsis that combines both a sandwich and a binding inhibition format in order to quantify high (CRP) and low abundant proteins (cytokines, PCT, neopterin) in parallel. Using the combined assay format the lowest detectable concentrations for CRP, IL-6, IL-8, IL-10, TNFα, PCT, and neopterin are 3mg/L, 15ng/L, 26ng/L, 65ng/L, 40ng/L, 78ng/L, and 0.46μg/L. Four different combined assay formats are tested, using separate or joint incubation steps of analytes and detection antibodies. Yet, the low limit of detection (LOD) and short processing time are contradictory: while the combined assay performed in a multistep protocol is extremely sensitive (e.g., the LOD for IL-6 is 15ng/L), but more time-consuming (4h), the all-in-one protocol takes onl... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5171615 Fri, 05 Aug 2011 23:00:00 +0100 5171615 http://www.medworm.com/index.php?rid=5171614&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21867669%26dopt%3DAbstract Authors: Parajuli N, Williams GJ Abstract The biosynthesis of aminocoumarin antibiotics involves the action of amide synthetases which construct amide bonds between aminocoumarins and various acyl moieties. Libraries of aminocoumarin analogues have been generated by in vivo fermentation, via feeding known amide synthetase substrates into producing microbial strains. Critically, such feeding studies rely on the inherent or engineered substrate promiscuity of each amide synthetase. We have initiated a program of directed evolution in order to create mutant amide synthetases for the synthesis of new nonnatural amino coumarin analogues. We used the clorobiocin enzyme CloL as a model amide synthetase to design and validate a fluorimetric high-throughput screen, which can be used to repo... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5171614 Fri, 05 Aug 2011 23:00:00 +0100 5171614 http://www.medworm.com/index.php?rid=5171613&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21867670%26dopt%3DAbstract We report an efficient system to produce and display properly folded disulfide-rich proteins facilitated by coupled complementary DNA (cDNA) display and protein disulfide isomerase-assisted folding. The results show that a neurotoxin protein containing four disulfide linkages can be displayed in the folded state. Furthermore, it can be refolded on a solid support that binds efficiently to its natural acetylcholine receptor. Probing the efficiency of the display proteins prepared by these methods provided up to 8-fold higher enrichment by the selective enrichment method compared with cDNA display alone, more than 10-fold higher binding to its receptor by the binding assays, and more than 10-fold higher affinities by affinity measurements. Cotranslational folding was found to have better eff... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5171613 Mon, 01 Aug 2011 23:00:00 +0100 5171613 http://www.medworm.com/index.php?rid=5171610&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21867674%26dopt%3DAbstract Authors: Alvarez M, Tremintin G, Wang J, Eng M, Kao YH, Jeong J, Ling VT, Borisov OV Abstract Recombinant monoclonal antibodies (MAbs) have become one of the most rapidly growing classes of biotherapeutics in the treatment of human disease. MAbs are highly heterogeneous proteins, thereby requiring a battery of analytical technologies for their characterization. However, incompatibility between separation and subsequent detection is often encountered. Here we demonstrate the utility of a generic on-line liquid chromatography-mass spectrometry method operated in a two-dimensional format toward the rapid characterization of MAb charge and size variants. Using a single chromatographic system capable of running two independent gradients, up to six fractions of interest from an ion excha... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5171610 Mon, 01 Aug 2011 23:00:00 +0100 5171610 http://www.medworm.com/index.php?rid=5139381&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21477578%26dopt%3DAbstract Authors: Huttunen R, Shweta , Martikkala E, Lahdenranta M, Virta P, Hänninen P, Härmä H Abstract Homogeneous luminescence-based microplate assays are desirable in high-throughput screening of new nuclear receptor regulators. Time-resolved fluorescence resonance energy transfer (TR-FRET) assays provide high sensitivity due to low background signal. The TR-FRET concept requires labeling of both ligand and receptor, making the assay format and its development relatively expensive and complex compared with single-label methods. To overcome the limitations of the multilabel methods, we have developed a single-label method for estrogen receptor (ER)-ligand binding based on quenching resonance energy transfer (QRET), where estradiol labeled with luminescent europium(III) chelate (Eu-E(... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5139381 Sun, 31 Jul 2011 23:00:00 +0100 5139381 http://www.medworm.com/index.php?rid=5139380&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21839063%26dopt%3DAbstract Authors: Sánchez-Vioque R, Rodríguez-Conde MF, Vioque J, Girón-Calle J, Santana-Méridas O, De-Los-Mozos-Pascual M, Izquierdo-Melero ME, Alaiz M Abstract A new colorimetric method based on the bleaching of the iodoplatinate ion has been developed for fast and easy determination of γ-glutamyl-S-ethenyl-cysteine (GEC) in narbon vetch (Vicia narbonensis L.) seeds. The calibration curve showed a good correlation (r(2)=0.9959) between absorbance and GEC amounts from 5.5 to 33μg (10-59.78μmol/L). The limits of detection and quantification were 1.16 and 3.55μmol/L, respectively, and no significant interferences from other sulfur-containing compounds were observed. The method showed excellent repeatability (relative standard deviation [RSD]=0.28%), reproducibility (RSD=4.4%), and ac... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5139380 Wed, 27 Jul 2011 23:00:00 +0100 5139380 http://www.medworm.com/index.php?rid=5091990&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21803020%26dopt%3DAbstract Authors: Dimitrov JD, Lacroix-Desmazes S, Kaveri SV The evaluation of antibody avidity by elution with chaotropic agents is a frequently used approach in research and diagnostics. It provides important information on the functional relevance of antibodies. However, in the literature, there is a large heterogeneity in the experimental settings for the determination of this important parameter. Here, we demonstrate that antibody concentration and the choice of chaotropic agent are critical for the reliable estimation of antibody avidity. PMID: 21803020 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5091990 Wed, 27 Jul 2011 23:00:00 +0100 5091990 http://www.medworm.com/index.php?rid=5091989&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21806960%26dopt%3DAbstract We report the development of a novel ELISA platform to quantitate hepatitis B virus X (HBx) protein refolding yields, which is critical for rational design and scaleup of aHBx bioprocess. HBx refolding yields were measured by determining the amount of HBx bound to immobilized GST-p53 on a "reduced glutathione"-functionalized maleimide surface. Refolding yields were distinguished from soluble yields, which were determined by measuring total HBx protein bound to a maleimide surface under reducing conditions. This platform is amenable to scaleup, and will expedite HBx production for structural and clinical studies, leading to the development of HBx-based therapy for liver cancer. PMID: 21806960 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5091989 Thu, 21 Jul 2011 23:00:00 +0100 5091989 http://www.medworm.com/index.php?rid=5041077&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fsites%2Fentrez%3Fcmd%3DSearch%26db%3Dpubmed%26term%3D%28%28%28%2522Anal%2520Biochem%2522%29%2520AND%2520%25222011%252F06%252F20%252020.45%2522%255BMHDA%255D%253A%25222011%252F07%252F20%252015.15%2522%255BMHDA%255D%29%29%2520NOT%2520%28%28%2520%28%28%2522Anal%2520Biochem%2522%255BTIAB%255D%29%29%2520AND%2520%25220001%2522%255BEDAT%255D%253A%25222011%252F06%252F20%252020.45%2522%255BEDAT%255D%29%29 138 new pubmed citations were retrieved for your search. Click on the search hyperlink below to display the complete search results: "Anal Biochem" These pubmed results were generated on 2011/07/20PubMed, a service of the National Library of Medicine, includes over 15 million citations for biomedical articles back to the 1950's. These citations are from MEDLINE and additional life science journals. PubMed includes links to many sites providing full text articles and other related resources. (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=5041077 Wed, 20 Jul 2011 19:15:03 +0100 5041077 http://www.medworm.com/index.php?rid=4948149&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21658362%26dopt%3DAbstract Authors: Bhattacharya R, Mukherjee D, Bhattacharyya D Sodium dodecyl sulfate (SDS) bound to proteins in solution could be estimated by passing through Extracti-Gel that removes free SDS followed by specific interaction of the fluorophore Rhodamine B with protein-bound SDS. The resulting fluorescence intensity is compared with a calibration curve. Whereas globular proteins respond to binding of 1.4mg SDS/mg protein under native conditions, "kinetically stable" proteins that are otherwise resistant to denaturation due to structural integrity show a low level of SDS binding. Analysis of the circular dichroism spectrum shows that in spite of the low level of SDS binding to kinetically stable proteins under nondenaturing conditions, the detergent generates considerable secondary structure i... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948149 Thu, 26 May 2011 23:00:00 +0100 4948149 http://www.medworm.com/index.php?rid=4948148&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21669176%26dopt%3DAbstract We present a simple and generic method for signal amplification based on the use of antibody-tagged fluorescent vesicles as labels for signal generation. To assess the gain in assay sensitivity, we performed a model assay for the detection of rabbit immunoglobulin G (IgG) and compare the limit of detection (LOD) of the vesicle assay with the LOD of a conventional assay performed with fluorescent reporter molecules. We evaluated the improvements for two fluorescence-based transduction setups: a high-sensitivity microarray reader (ZeptoREADER) and a conventional confocal scanner. In all cases, our strategy led to an increase in sensitivity. However, the efficiency of signal amplification widely depended on the type of illumination; whereas an approximately 2-fold increase in sensitivity was ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948148 Thu, 26 May 2011 23:00:00 +0100 4948148 http://www.medworm.com/index.php?rid=4948147&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21669177%26dopt%3DAbstract Authors: Hayes WA, Mills DS, Neville RF, Kiddie J, Collins LM The FRAP reagent contains 2,4,6-tris(2-pyridyl)-s-triazine, which forms a blue-violet complex ion in the presence of ferrous ions. Although the FRAP (ferric reducing/antioxidant power) assay is popular and has been in use for many years, the correct molar extinction coefficient of this complex ion under FRAP assay conditions has never been published, casting doubt on the validity of previous calibrations. A previously reported value of 19,800 is an underestimate. We determined that the molar extinction coefficient was 21,140. The value of the molar extinction coefficient was also shown to depend on the type of assay and was found to be 22,230 under iron assay conditions, in good agreement with published data. Redox titration... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948147 Thu, 26 May 2011 23:00:00 +0100 4948147 http://www.medworm.com/index.php?rid=4948143&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21669181%26dopt%3DAbstract Authors: Copeland RA, Basavapathruni A, Moyer M, Scott MP Jump dilution analysis is commonly used to evaluate the reversibility of inhibition and to quantify the residence time of the inhibitor-enzyme complex. During hit and lead characterization, one sometimes observes apparently linear progress curves after jump dilution that display activity recoveries that are intermediate between those expected for fully reversible and irreversible inhibition. Computer simulations of progress curves after jump dilution indicate that seemingly linear progress curves can result when dealing with tight-binding inhibitors if substoichiometric concentrations of inhibitor are preincubated with enzyme. In this situation, the activity recovered is comparable to that expected for instantaneously reversible... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948143 Thu, 26 May 2011 23:00:00 +0100 4948143 http://www.medworm.com/index.php?rid=4948145&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21669179%26dopt%3DAbstract This article describes the adaptation of a simple colorimetric assay for inorganic pyrophosphate to the enzyme 3-deoxy-d-manno-octulosonate cytidylyltransferase (CMP-KDO synthetase, KdsB, EC 2.7.7.38), a key enzyme in the biosynthesis of lipopolysaccharide (LPS) in Gram-negative organisms. This assay is particularly useful because it can be combined with the malachite green (MG) assay for inorganic phosphate to form an assay system capable of determining inorganic phosphate and inorganic pyrophosphate in the same solution (the MG/EK (eikonogen reagent) assay). This assay system has the potential for simultaneous screening of the 3-deoxy-d-manno-octulosonate (KDO) biosynthesis pathway. We tested this potential using two enzymes, KdsB and KdsC, involved in the biosynthesis and use of the key... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948145 Wed, 25 May 2011 23:00:00 +0100 4948145 http://www.medworm.com/index.php?rid=4948146&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21669178%26dopt%3DAbstract Authors: Thirulogachandar V, Pandey P, Vaishnavi CS, Reddy MK Identifying a good transgenic event from the pool of putative transgenics is crucial for further characterization. In transgenic plants, the transgene can integrate in either single or multiple locations by disrupting the endogenes and/or in heterochromatin regions causing the positional effect. Apart from this, to protect the unauthorized use of transgenic plants, the signature of transgene integration for every commercial transgenic event needs to be characterized. Here we show an affinity-based genome walking method, named locus-finding (LF) PCR (polymerase chain reaction), to determine the transgene flanking sequences of rice plants transformed by Agrobacterium tumefaciens. LF PCR includes a primary PCR by a degenerated ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948146 Mon, 23 May 2011 23:00:00 +0100 4948146 http://www.medworm.com/index.php?rid=4948142&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21672511%26dopt%3DAbstract Authors: Huang YQ, Ruan GD, Liu JQ, Gao Q, Feng YQ Here we report a new isotopic pair of derivatization reagents, ω-bromoacetonylquinolinium bromide (BQB) and d(7)-ω-bromoacetonylquinolinium bromide (d(7)-BQB). BQB and d(7)-BQB both can rapidly and selectively react with thiols in acidic medium within 3min with the aid of a microwave. Reduced thiols and total thiols in urine were labeled with BQB and d(7)-BQB, respectively. The BQB- and d(7)-BQB-labeled urine samples were then mixed and separated on a HILIC (hydrophilic interaction chromatography) column followed by electrospray ionization tandem mass spectrometry (ESI-MS/MS) detection. The new strategy, which we have named isotope differential derivatization, allows us to simultaneously determine thiols and oxidized thiols in a sing... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948142 Mon, 23 May 2011 23:00:00 +0100 4948142 http://www.medworm.com/index.php?rid=4948154&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21645490%26dopt%3DAbstract Authors: Mahmoud W, Rousserie G, Reveil B, Tabary T, Millot JM, Artemyev M, Oleinikov VA, Cohen JH, Nabiev I, Sukhanova A Semiconductor quantum dots (QDs) are proved to be unique fluorescent labels providing excellent possibilities for high-throughput detection and diagnostics. To explore in full QDs' advantages in brightness, photostability, large Stokes shift, and tunability by size fluorescence emission, they should be rendered stable in biological fluids and tagged with the target-specific capture molecules. Ideal QD-based nanoprobes should not exceed 15nm in diameter and should contain on their surface multiple copies of homogeneously oriented highly active affinity molecules, for example, antibodies (Abs). Direct conjugation of QDs with the Abs through cross-linking of QDs' amine... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948154 Thu, 19 May 2011 23:00:00 +0100 4948154 http://www.medworm.com/index.php?rid=4948152&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21651885%26dopt%3DAbstract Authors: Parra J, Esteve-Turrillas FA, Abad-Somovilla A, Agulló C, Mercader JV, Abad-Fuentes A The relevance of the linker tethering site in haptens was investigated for antibody generation and immunoassay development. Three derivatives of the strobilurin fungicide picoxystrobin were synthesized with the same functionalized spacer arm located at three different positions. Protein conjugates of those haptens were employed as immunogens, and novel polyclonal antibodies were produced and characterized. All haptens afforded highly specific antibodies, but different affinities to the free analyte were observed among the obtained antisera. Next, competitive enzyme-linked immunosorbent assays were studied in several formats, and site heterology was confirmed as an effective strategy for dete... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948152 Thu, 19 May 2011 23:00:00 +0100 4948152 http://www.medworm.com/index.php?rid=4948151&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21651886%26dopt%3DAbstract Authors: Krömer JO, Dietmair S, Jacob SS, Nielsen LK l-Alanyl-l-glutamine (also known as Ala-Gln or GlutaMAX) is widely used as a stable l-glutamine source in cell culture for the production of biopharmaceuticals. System approaches for the optimization of production processes require the analysis of all major substrates and products. We have compared four alternative detection systems for l-alanyl-l-glutamine in culture broth. Matrix effects prevented the use of ultraviolet or evaporative light scattering detection. Fluorescence detection used in routine amino acid protocols is compatible with culture broth and has a broad linear dynamic range. Mass spectrometry has superior sensitivity and can be integrated into quantitative metabolomic workflows. PMID: 21651886 [PubMed - as supp... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948151 Thu, 19 May 2011 23:00:00 +0100 4948151 http://www.medworm.com/index.php?rid=4948144&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21669180%26dopt%3DAbstract Authors: Arakawa T, Ohta T, Abiko Y, Okayama M, Mizoguchi I, Takuma T DNA methylation is an important epigenetic modification that leads to a wide variety of biological functions, including transcription, growth and development, and diseases associated with altered gene expression such as cancers. However, tools to insert site-specific methylation into DNA for analyzing epigenetic functions are limited. Here we describe a novel polymerase chain reaction (PCR)-based approach to provide site-specific DNA methylation at any site, including CpG or CpNpG islands. This method is simple and versatile, and it consists of four steps to construct the DNA methylation vector: (I) design and synthesis of methylated primers, (II) PCR amplification, (III) isolation of single-stranded DNA, and (IV) an... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948144 Thu, 19 May 2011 23:00:00 +0100 4948144 http://www.medworm.com/index.php?rid=4948150&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21651887%26dopt%3DAbstract In this study, we were able to expand an existing protocol to evaluate miRNA expression in both vertebrate and invertebrate animals for which mature miRNAs remain unsequenced. This method allows the researcher to sequence reverse transcription-polymerase chain reaction products, validating miRNA-specific amplification and providing the opportunity to add to the current body of knowledge of miRNA annotation. PMID: 21651887 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948150 Wed, 18 May 2011 23:00:00 +0100 4948150 http://www.medworm.com/index.php?rid=4948157&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21640067%26dopt%3DAbstract Authors: Yang M, Sun S, Kostov Y, Rasooly A An automated point-of-care (POC) immunodetection system for immunological detection of staphylococcal enterotoxin B (SEB) was designed, fabricated, and tested. The system combines several elements: (i) enzyme-linked immunosorbent assay-lab-on-a-chip (ELISA-LOC) with fluidics, (ii) a charge-coupled device (CCD) camera detector, (iii) pumps and valves for fluid delivery to the ELISA-LOC, (iv) a computer interface board, and (v) a computer for controlling the fluidics, logging, and data analysis of the CCD data. The ELISA-LOC integrates a simple microfluidic system into a miniature 96-well sample plate, allowing the user to carry out immunological assays without a laboratory. The analyte is measured in a sandwich ELISA assay format combined with... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948157 Mon, 16 May 2011 23:00:00 +0100 4948157 http://www.medworm.com/index.php?rid=4948156&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21640698%26dopt%3DAbstract Authors: Zhang B, Hodgson J, Hancock W, Powers R Large-scale nuclear magnetic resonance (NMR) tube cleaning is currently a bottleneck in high-throughput NMR ligand affinity screens. Expensive alternatives include discarding the NMR tubes after a single use (∼US $2-$8/tube), using commercial NMR tube cleaners (∼$15,000), and abandoning NMR tubes for flow probe technology (∼$75,000). Instead, we describe a relatively inexpensive (∼$400) and easily constructed apparatus that can clean 180 NMR tubes per hour while using a modest amount of solvent. The application of this apparatus significantly shortens the time to recycle NMR tubes while avoiding cross-contamination and tube damage. PMID: 21640698 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948156 Mon, 16 May 2011 23:00:00 +0100 4948156 http://www.medworm.com/index.php?rid=4948155&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21640699%26dopt%3DAbstract In this study, we describe a high-performance resin that offers exceptional detergent removal for proteins and peptides. When used in a spin column format, this resin dramatically improves protein and peptide MS results by more than 95% removal of 1-5% detergents, including sodium dodecyl sulfate (SDS), sodium deoxycholate, Chaps, Triton X-100, Triton X-114, NP-40, Brij-35, octyl glucoside, octyl thioglucoside, and lauryl maltoside, with high recovery of proteins and peptides. Postcolumn liquid chromatography-tandem MS (LC-MS/MS) analysis of trypsin digests of bovine serum albumin (BSA) and HeLa cell lysate revealed excellent sequence coverage, indicating successful removal of detergent from the peptides. Matrix-assisted laser desorption/ionization (MALDI)-MS analysis of unprocessed and pr... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948155 Mon, 16 May 2011 23:00:00 +0100 4948155 http://www.medworm.com/index.php?rid=4948153&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21645491%26dopt%3DAbstract Authors: Kovar JL, Xu X, Draney D, Cupp A, Simpson MA, Michael Olive D Bone-specific compounds have been used effectively for the detection of bone mineralization, growth, and morphological changes. These agents typically contain iminodiacetic acid groups that can form complexes with apatite and fluoresce in the visible spectrum. We exploited a subset of these chemical chelators to produce a near-infrared (NIR) optical bone marker for preclinical animal imaging. By conjugating target compounds to IRDye 800CW, we extended the effective fluorescence signal detection to the NIR region without affecting the compound's ability to function as a marker of the mineralization process. Calcein and a tetracycline derivative (BoneTag agent [BT]) bound specifically to differentiated mineralized ost... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4948153 Wed, 11 May 2011 23:00:00 +0100 4948153 http://www.medworm.com/index.php?rid=4901102&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21620793%26dopt%3DAbstract Authors: Adhikari S, Karmahapatra SK, Elias H, Dhopeshwarkar P, Scott Williams R, Byers S, Uren A, Roy R Tyrosyl DNA phosphodiesterase 2 (TDP2), a newly discovered enzyme that cleaves 5'-phosphotyrosyl bonds, is a potential target for chemotherapy. TDP2 possesses both 3'- and 5'-tyrosyl-DNA phosphodiesterase activity, which is generally measured in a gel-based assay using 3'- and 5'-phosphotyrosyl linkage at the 3' and 5' ends of an oligonucleotide. To understand the enzymatic mechanism of this novel enzyme, the gel-based assay is useful, but this technique is cumbersome for TDP2 inhibitor screening. For this reason, we have designed a novel assay using p-nitrophenyl-thymidine-5'-phosphate (T5PNP) as a substrate. This assay can be used in continuous colorimetric assays in a 96-well for... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901102 Wed, 11 May 2011 23:00:00 +0100 4901102 http://www.medworm.com/index.php?rid=4901100&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21621501%26dopt%3DAbstract Authors: Shih AM, Shin OH Exocytosis is one of the most crucial and ubiquitous processes in all of biology. This event is mediated by the formation of SNARE (soluble N-ethylmaleimide-sensitive factor attachment protein receptor) complexes, ternary assemblies of syntaxin, SNAP23/SNAP25 (synaptosomal-associated protein of 23 or 25kDa), and synaptobrevin. The exocytotic process can be further regulated by complexin, which interacts with the SNARE complex. Complexin is involved in a Ca(2+)-triggered exocytotic process. In eukaryotic cells, multiple isoforms of SNARE proteins are expressed and are involved in distinct types of exocytosis. To understand the underlying biochemical mechanism of various exocytotic processes mediated by different SNARE protein isoforms, we systematically analyze... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901100 Wed, 11 May 2011 23:00:00 +0100 4901100 http://www.medworm.com/index.php?rid=4901098&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21624343%26dopt%3DAbstract Authors: Cummings M, McGinley CV, Wilkinson N, Field SL, Duffy SR, Orsi NM Laser capture microdissection of frozen tissue sections allows homogeneous cell populations to be isolated for expression profiling. However, this requires striking a balance between retaining adequate morphology for accurate microdissection and maintaining RNA integrity. Various staining protocols were applied to frozen endometrial carcinoma tissue sections. Although alcohol-based methods were superior to aqueous stains for maintaining RNA integrity, they suffered from irreproducible staining intensity. We developed a modified alcohol-based, buffered cresyl violet staining protocol that provides reproducible staining with minimal RNA degradation suitable for tissues with moderate to high levels of intrinsic RNa... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901098 Wed, 11 May 2011 23:00:00 +0100 4901098 http://www.medworm.com/index.php?rid=4901097&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21624344%26dopt%3DAbstract Authors: Gan SW, Vararattanavech A, Nordin N, Eshaghi S, Torres J The use of blue native polyacrylamide gel electrophoresis (BN-PAGE) has been reported in the literature to retain both water-soluble and membrane protein complexes in their native hetero-oligomeric state and to determine the molecular weight of membrane proteins. However, membrane proteins show abnormal mobility when compared with water-soluble markers. Although one could use membrane proteins as markers or apply a conversion factor to the observed molecular weight to account for the bound Coomassie blue dye, when one just wants to assess homo-oligomeric size, these methods appear to be too time-consuming or might not be generally applicable. Here, during detergent screening studies to identify the best detergent for ach... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901097 Wed, 11 May 2011 23:00:00 +0100 4901097 http://www.medworm.com/index.php?rid=4901101&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21621500%26dopt%3DAbstract Authors: Sakasegawa SI, Hayashi J, Ikura Y, Ueda S, Imamura S, Kumazawa T, Nishimura S, Ohshima T, Sakuraba H Pyruvate phosphate dikinase (PPDK, EC 2.7.9.1) from the hyperthermophile Thermotoga maritima was biochemically characterized with the aim of establishing a colorimetric assay for inorganic pyrophosphate (PPi). When heterologously expressed in Escherichia coli, T. maritima PPDK (TmPPDK) was far more stable any other PPDK reported so far: it retained >90% of its activity after incubation for 1h at 80°C, and >80% of its activity after incubation for 20min at pHs ranging from 6.5 to 10.5 (50°C). In contrast to PPDKs from protozoa and plants, this TmPPDK showed very long-term stability at low temperature: full activity was retained even after storage for at least 2years at 4... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901101 Tue, 10 May 2011 23:00:00 +0100 4901101 http://www.medworm.com/index.php?rid=4901104&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21620791%26dopt%3DAbstract Authors: Akter F, Mie M, Kobatake E Ultrasensitive detection of specific, low level proteins in body fluids is particularly challenging. Owing to the extreme sensitivity of the polymerase chain reaction step, the requirements for immuno-rolling circle amplification (immuno-RCA) are much more stringent than for conventional ELISA. Here, we report the development of a rolling circle amplification procedure using multibinding fusion protein to enhance signals of immuno-RCA to detect a cancer biomarker, α-fetoprotein (AFP). We successfully avoid the covalent linkage between antibody and DNA or antibody and biotin/streptavidin by introducing a new genetically engineered fusion protein which contains the C2 domain of protein G and biotin acceptor peptide (BAP) which is intended to maintain ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901104 Mon, 09 May 2011 23:00:00 +0100 4901104 http://www.medworm.com/index.php?rid=4901103&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21620792%26dopt%3DAbstract Authors: Kilcoyne M, Gerlach JQ, Farrell MP, Bhavanandan VP, Joshi L Microtiter plate colorimetric assays are widely used for analysis of carbohydrates and glycoconjugates. However, mucins are often not easily detected, as they have low neutral sugar content. We have adapted and optimised the periodic acid-Schiff's reagent (PAS) staining for microtiter plate assay by examining five factors: concentration and volume of periodic acid, oxidation time, volume of Schiff's reagent, and color development time. This assay requires just 25μl of sample, utilises standardised Schiff's reagent, and has decreased assay time (140min to completion). Seventeen monosaccharides (acidic, neutral, basic, phosphorylated, and deoxy) and four disaccharides were assessed. PAS-positive carbohydrates (amino, N... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901103 Mon, 09 May 2011 23:00:00 +0100 4901103 http://www.medworm.com/index.php?rid=4901105&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21609711%26dopt%3DAbstract Authors: Chiou CC, Chen SW, Luo JD, Chien YT Triplex-forming oligonucleotides (TFOs) are sequence-dependent DNA binders that may be useful for DNA targeting and detection. A sensitive and convenient method to monitor triplex formation by a TFO and its target DNA duplex is required for the application of TFO probes. Here we describe a novel design by which triplex formation can be monitored homogeneously without prelabeling the target duplex. The design uses a TFO probe tagged with a fluorophore that undergoes fluorescence resonance energy transfer with fluorescent dyes that intercalate into the target duplex. Through color compensation analysis, the specific emission of the TFO probe reveals the status of the triple helices. We used this method to show that triple helix formation with ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901105 Sat, 07 May 2011 23:00:00 +0100 4901105 http://www.medworm.com/index.php?rid=4901099&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21621502%26dopt%3DAbstract Authors: Wilson DJ, Shi C, Duckworth BP, Muretta JM, Manjunatha U, Sham YY, Thomas DD, Aldrich CC Cofactor biosynthetic pathways represent a rich source of potential antibiotic targets. The second step in biotin biosynthesis is performed by BioA, a pyridoxal 5'-phosphate (PLP)-dependent enzyme. This enzyme has been confirmed as a candidate target in Mycobacterium tuberculosis; however, the current bioassay used to measure BioA activity is cumbersome and low throughput. Here we describe the design, development, and optimization of a continuous coupled fluorescence displacement assay to measure BioA activity. In this coupled assay, BioD converts the product of the BioA-catalyzed reaction into dethiobiotin, which is subsequently detected by displacement of a fluorescently labeled dethiobi... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901099 Sat, 07 May 2011 23:00:00 +0100 4901099 http://www.medworm.com/index.php?rid=4901107&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21605540%26dopt%3DAbstract Authors: Lalezari P, Lekhraj R, Casper D A new method for extraction and concentration of organic dyes that uses a reagent composed of a nonionic detergent mixed with an alcohol is described. We have observed that water-soluble organic dyes are also soluble in nonionic detergents and can be extracted by adding salt, which separates the dye-detergent component from the aqueous phase. We have also found that mixing nonionic detergents with alcohols markedly reduces their viscosity and produces stable, free-flowing, and effective reagents for color extraction. On the basis of these observations, we used a mixture of Triton X-100 and 1-butanol and observed that water-soluble natural and synthetic chromophores, as well as dyes generated in biochemical reactions, can be extracted, concentrat... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901107 Thu, 05 May 2011 23:00:00 +0100 4901107 http://www.medworm.com/index.php?rid=4901106&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21609710%26dopt%3DAbstract Authors: Zhang G, Zhang Y, Fast DM, Lin Z, Steenwyk R Oxytocin (OT) is a neuropeptide with an extremely low endogenous level (low pg/ml) in human plasma. It is very challenging to develop a highly sensitive assay to measure endogenous OT, including radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA). Electrospray ionization (ESI) liquid chromatography-tandem mass spectrometry (LC-MS/MS) can provide high-throughput and selective methods for quantification of peptides in biological samples. A novel and highly sensitive two-dimensional LC-MS/MS (2D-LC-MS/MS) assay combining solid-phase extraction (SPE) has been developed and validated for the determination of endogenous OT in both human and rat plasma. The lower limit of quantification (LLOQ) was 1.00pg/ml for human and 5... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901106 Thu, 05 May 2011 23:00:00 +0100 4901106 http://www.medworm.com/index.php?rid=4901109&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21601558%26dopt%3DAbstract Authors: Miura H, Inoko H, Inoue I, Tanaka M, Sato M, Ohtsuka M Because construction of expression vectors is the first requisite in the functional analysis of genes, development of simple cloning systems is a major requirement during the postgenomic era. In the current study, we developed cloning vectors for gain- or loss-of-function studies by using the GFPuv gene as a positive/negative indicator of cloning. These vectors allow us to easily detect correct clones and obtain expression vectors from a simple procedure by means of the combined use of the GFPuv gene and a type IIS restriction enzyme. PMID: 21601558 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901109 Wed, 04 May 2011 23:00:00 +0100 4901109 http://www.medworm.com/index.php?rid=4901112&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21601555%26dopt%3DAbstract Authors: Kajiyama T, Kuwahara M, Goto M, Kambara H Conventional pyrosequencing using 2'-deoxyadenosine-5'-O-(1-thiotriphosphate) (dATPαS) is problematic due to the high cost of the substrate (dATPαS) and deterioration in the accuracy of incorporation to read through poly(T) regions. One reason for these problems is that dATPαS has a sulfur on the α-phosphate and also has isomers (Sp and Rp). To solve these problems, 11 nucleotide substrates, which could replace dATPαS in pyrosequencing, were newly synthesized. All substrates were modified on the seventh or eighth position of the adenine base from normal dATP. We found that the substrate that had an ethenyl-linked modified group on the seventh position of the adenine base had low activity in the luciferase reaction and high incorpo... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901112 Tue, 03 May 2011 23:00:00 +0100 4901112 http://www.medworm.com/index.php?rid=4901111&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21601556%26dopt%3DAbstract We present a protease inhibitor-free buffer, containing cobalt chloride, which is effective at stabilizing HIF-1α, while being inexpensive, straightforward, and convenient, and has potential for widespread application. PMID: 21601556 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901111 Thu, 28 Apr 2011 23:00:00 +0100 4901111 http://www.medworm.com/index.php?rid=4901110&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21601557%26dopt%3DAbstract Authors: Lin HY, Lin SE, Chien SF, Chern MK The efficiency of transformation by electroporation has been known to be compromised by strain dependency. A high efficiency protocol is still lacking for distinct two-hybrid yeast strains of diverse genetic features. Here, we used 0.5M lithium acetate (LiAc) and 50mM Tris-HCl with 5mM EDTA (pH 7.5), i.e., fivefold the standard concentrations, and voltage at 1.0 to develop a protocol which, for the first time, is able to effect an average efficiency of 1.84×10(6)transformants/μg DNA for three commonly used yeast strains committed to two-hybrid screening experiments. PMID: 21601557 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901110 Thu, 28 Apr 2011 23:00:00 +0100 4901110 http://www.medworm.com/index.php?rid=4901108&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21601559%26dopt%3DAbstract Authors: Gemene KL, Meyerhoff ME A novel electrochemical method, termed flash chronopotentiometry (FCP), is used to develop a rapid and sensitive method for detecting protease activities. In this method, an appropriate current pulse is applied across a polycation-selective polymer membrane to induce a strong flux of the polycationic peptides from the sample phase into the organic membrane of the electrode. During this current pulse, the cell potential (EMF) is monitored continuously, and is a function of the polypeptide concentration. The imposed current causes a local depletion of the polypeptide at the sample/membrane interface, which yields a drastic potential change in the observed chronopotentiogram at a characteristic time, called the transition time (τ). For a given magnitude o... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901108 Thu, 28 Apr 2011 23:00:00 +0100 4901108 http://www.medworm.com/index.php?rid=4901115&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21600183%26dopt%3DAbstract Authors: Stengel G, Purse B, Kuchta RD The cytosine analogs 1,3-diaza-2-oxophenothiazine (tC) and 1,3-diaza-2-oxophenoxazine (tCo) stand out among fluorescent bases due to their unquenched fluorescence emission in double-stranded DNA. Recently, we reported a method for the generation of densely tCo-labeled DNA by polymerase chain reaction (PCR) that relied on the use of the extremely thermostable Deep Vent polymerase. We have now developed a protocol that employs the more commonly used Taq polymerase. Supplementing the PCR with Mn(2+) or Co(2+) ions dramatically increased the amount of tCo triphosphate (dtCoTP) incorporated and, thus, enhanced the brightness of the PCR products. The resulting PCR products could be easily detected in gels based on their intrinsic fluorescence. The Mn(2+... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901115 Tue, 26 Apr 2011 23:00:00 +0100 4901115 http://www.medworm.com/index.php?rid=4901114&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21600184%26dopt%3DAbstract Authors: Umezu T, Ohyashiki K, Ohyashiki JH A method for quantifying global DNA methylation using fluorescence correlation spectroscopy (FCS) has been established. The single-molecule methylation assay (SMMA) is based on two methodologies. One methodology, FCS, estimates the translational diffusion coefficient of molecules in solution, whereas the other methodology uses the high affinity of methyl-CpG-binding domain protein 2 (MBD2) to bind specifically to methylated DNA. We studied the specific binding rates of fluorescence-labeled MBD2 and methylated DNA from biological samples using the automated FCS system. Using a standard curve with methylated control DNA, we developed the SMMA index to assess the global DNA methylation level of the biological samples. A marked decrease in the SM... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901114 Tue, 26 Apr 2011 23:00:00 +0100 4901114 http://www.medworm.com/index.php?rid=4901113&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21600185%26dopt%3DAbstract Authors: Lan D, Huang G, Shao H, Zhang L, Ma L, Chen S, Xu A Proteins fused to the elastin-like polypeptide (ELP) tag can be selectively separated from crude cell extract without chromatography. To avoid the interference of the ELP tag on properties of the target protein, it is necessary to remove the ELP tag from target protein by protease digestion. Therefore, an additional chromatographic purification step is required to remove the proteases, and this is time- and labor-consuming. Here we demonstrate the utility of the ELP-tagged proteases for cleavage of ELP fusion proteins, allowing one-step removal of the cleaved ELP tag and ELP-tagged proteases without chromatography. PMID: 21600185 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4901113 Tue, 26 Apr 2011 23:00:00 +0100 4901113 http://www.medworm.com/index.php?rid=4852378&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21570941%26dopt%3DAbstract Authors: Mathew B, Bhat V, Mandal AK Molecular analysis of hemoglobin variants is crucial in the diagnosis of hemoglobinopathies. Routinely used techniques for identifying variants include alkaline gel electrophoresis and automated HPLC. Sometimes comigration of variants in electrophoresis or coelution in HPLC provides ambiguous results. Due to high sequence homology between normal and variant hemoglobin, proteomic analysis using LC/ESI-MS data is also challenging. Here we describe a novel method wherein alkaline gel electrophoresis and MALDI-MS were used in combination to characterize variant samples such as Hb FSD and Hb D-Iran unambiguously. The method is rapid, efficient, and cost effective. In the future, it can be applied as a diagnostic tool. PMID: 21570941 [PubMed - as supp... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852378 Tue, 26 Apr 2011 23:00:00 +0100 4852378 http://www.medworm.com/index.php?rid=4852374&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21570945%26dopt%3DAbstract Authors: Askin SP, Morin I, Schaeffer PM Proteases are implicated in various diseases and several have been identified as potential drug targets or biomarkers. As a result, protease activity assays that can be performed in high throughput are essential for the screening of inhibitors in drug discovery programs. Here we describe the development of a simple, general method for the characterization of protease activity and its use for inhibitor screening. GFP was genetically fused to a comparatively unstable Tus protein through an interdomain linker containing a specially designed protease site, which can be proteolysed. When this Tus-GFP fusion protein substrate is proteolysed it releases GFP, which remains in solution after a short heat denaturation and centrifugation step used to elimi... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852374 Tue, 26 Apr 2011 23:00:00 +0100 4852374 http://www.medworm.com/index.php?rid=4852371&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21596013%26dopt%3DAbstract Authors: Herath K, Bhat G, Miller PL, Wang SP, Kulick A, Andrews-Kelly G, Johnson C, Rohm RJ, Lassman ME, Previs SF, Johns DG, Hubbard BK, Roddy TP Protein synthesis can be estimated by measuring the incorporation of a labeled amino acid into a proteolytic peptide. Although prelabeled amino acids are typically administered, recent studies have tested (2)H(2)O; the assumption is that there is rapid equilibration of (2)H (in body water) with the carbon-bound hydrogens of amino acids before those amino acids are incorporated into a protein(s). We have determined the temporal changes in (2)H labeling of body water and amino acids that should build confidence in (2)H(2)O-based studies of protein synthesis when one aims to measure the (2)H labeling of proteolytic peptides. PMID: 21596013... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852371 Tue, 26 Apr 2011 23:00:00 +0100 4852371 http://www.medworm.com/index.php?rid=4852370&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21596014%26dopt%3DAbstract We describe a fast and informative method to investigate the posttranslational modifications of monoclonal antibodies (MAbs). The MAb is first digested by a specific enzyme that cleaves heavy chains under the hinge domain. After reduction of disulfide bridges, three polypeptide chains of approximately 25kDa are released and analyzed by liquid chromatography-mass spectrometry (LC-MS). By bisecting the heavy chains prior to MS analysis, this method provides a better MS resolution and facilitates the study of the N-linked glycans as well as of other modifications (loss of C-terminal lysine, pyroglutamination, and oxidation). The sample preparation and analysis can be performed within few hours. PMID: 21596014 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852370 Tue, 26 Apr 2011 23:00:00 +0100 4852370 http://www.medworm.com/index.php?rid=4852369&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21596015%26dopt%3DAbstract Authors: Nestal de Moraes G, Carvalho E, Maia RC, Sternberg C Cell death by apoptosis triggers the engagement of a conserved intracellular machinery of execution, involving mainly the activation of the caspase family of cysteine proteases. Caspase-3 is a common effector of most of the apoptotic pathways and is able to cleave several target proteins whose degradation will contribute to the execution phase of the cell demise program. Here we present a modification of the Western blot protocol to improve sensitivity of caspase-3 detection, providing a valuable tool to access its activation in biological specimens. PMID: 21596015 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852369 Tue, 26 Apr 2011 23:00:00 +0100 4852369 http://www.medworm.com/index.php?rid=4852376&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21570943%26dopt%3DAbstract Authors: Shapiro AB, Hajec L, Gao N A new, homogeneous, high-throughput-compatible assay method is described for the fluorescence-based quantitation of nanomolar concentrations of ribonucleoside diphosphates (rNDPs). The principle of the method is the conversion of the rNDPs to RNA by the enzyme polynucleotide phosphorylase (EC 2.7.7.8) and detection of the RNA by the increased fluorescence of a commercial nucleic acid detection dye. A commercial RNA homopolymer complementary to the RNA product is included to increase the sensitivity for ADP and UDP. Standard curves for nanomolar concentrations of ADP, UDP, GDP, and CDP are shown. The assay detected 75nM ADP produced by the pyruvate kinase-catalyzed phosphorylation of pyruvate with a signal-to-baseline ratio of 2.8. The assay may be us... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852376 Sat, 23 Apr 2011 23:00:00 +0100 4852376 http://www.medworm.com/index.php?rid=4852377&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21570942%26dopt%3DAbstract Authors: An Y, Lv S, Sun S, Chen L We have developed a convenient method for family shuffling of amino acid sequences, termed digestion-after-shuffling. After DNA shuffling of homologous genes, plasmid mixture is extracted from a library and used for several double digestions with restriction enzymes. For each double digestion, two restriction enzymes are selected, corresponding to the single restriction sites of different parental genes. After digestions, fragments with expected sizes are obtained by gel purification and religated to construct recombinant plasmids. Thus, the obtained genes should be chimeras and have at least two restriction sites originating from different parental sequences. PMID: 21570942 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852377 Fri, 22 Apr 2011 23:00:00 +0100 4852377 http://www.medworm.com/index.php?rid=4852375&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21570944%26dopt%3DAbstract Authors: Laha M, Panizzi P, Nahrendorf M, Bock PE We previously demonstrated that streptokinase (SK) can be used to generate active site-labeled fluorescent analogs of plasminogen (Pg) by virtue of its nonproteolytic activation of zymogen. The method is versatile and allows stoichiometric and active site-specific incorporation of any one of many molecular probes. The limitation of the labeling approach is that it is both time-consuming and low yield. Here we demonstrate an improved method for the preparation of labeled Pg analogs by the use of an engineered SK mutant fusion protein with both COOH- and NH(2)-terminal His(6) tags. The NH(2)-terminal tag is followed by a tobacco etch virus proteinase cleavage site to ensure that the SK Ile(1) residue, essential for conformational activati... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852375 Fri, 22 Apr 2011 23:00:00 +0100 4852375 http://www.medworm.com/index.php?rid=4852372&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21575589%26dopt%3DAbstract Authors: Behrends V, Tredwell GD, Bundy JG The software package AMDIS performs gas chromatography-mass spectrometry (GC-MS) peak deconvolution but tends to produce false positives and leaves missing values where peaks are found in only a proportion of a set of chromatograms. We have developed a software complement to AMDIS that (i) allows rapid manual inspection of chromatographic peaks across all samples to confirm data quality and (ii) for a given sample set, integrates peak areas across all samples even where AMDIS deconvolution would leave missing values. The freely available package runs within the commercial Matlab environment and is useful where GC-MS is used to profile complex mixtures. PMID: 21575589 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852372 Fri, 22 Apr 2011 23:00:00 +0100 4852372 http://www.medworm.com/index.php?rid=4852373&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21570946%26dopt%3DAbstract In this study, rotavirus from stool specimens was successfully amplified and detected using the RT-PCR microfluidic system within 1h, and the limit of detection of the RNA concentration was estimated to be 3.6×10(4) copiesμl(-1). Compared with a large-scale apparatus, the integrated microfluidic system presented here can perform rapid nucleic acid amplification and analysis, possibly making it a crucial platform for future diagnosis application. PMID: 21570946 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852373 Thu, 21 Apr 2011 23:00:00 +0100 4852373 http://www.medworm.com/index.php?rid=4852384&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21549681%26dopt%3DAbstract Authors: Rae T, Bonn R, Lang E, Stamenova S, Burgos G, Rupprecht K, Fishpaugh J Classic blotting methods remain a commonly applied approach to specific protein identification in gel electrophoresis of complex mixtures despite the inherent difficulty in band or spot matching due to significant variability of protein migration or localization in replicate blotting experiments. A direct application of both protein stain and protein blotting on a single membrane significantly reduces the complexity of the experiment and provides increased confidence of signal matching. Digital alignment of images acquired from both total protein stain and blotting development modes on a single membrane allows unambiguous spot or band assignments in these experiments as well as retention of quantitative inf... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852384 Tue, 19 Apr 2011 23:00:00 +0100 4852384 http://www.medworm.com/index.php?rid=4852383&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21549682%26dopt%3DAbstract Authors: Lu WW, Sun JR, Wu SS, Lin WH, Kung SH A dual reporter cell assay (DRCA) that allows real-time detection of herpes simplex virus (HSV) infection was developed. This was achieved by stable transfection of cells with an expression cassette that contains the dual reporter genes, secreted alkaline phosphatase (SEAP) and enhanced green fluorescent protein (EGFP), under the control of an HSV early gene promoter. Baby hamster kidney (BHK) and Chinese hamster ovary (CHO) cell lines were used as parental cell lines because the former is permissive for both HSV serotypes, HSV-1 and HSV-2, whereas the latter is susceptible to infection only by HSV-2. The DRCA permitted differential detection of HSV-1 and HSV-2 by observation of EGFP-positive cells, as substantiated by screening a total of... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852383 Tue, 19 Apr 2011 23:00:00 +0100 4852383 http://www.medworm.com/index.php?rid=4852382&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21565151%26dopt%3DAbstract Authors: Sajic T, Hopfgartner G, Szanto I, Varesio E A comparative study of three detergent-free protein extraction protocols-a differential centrifugal fractionation, a delipidation protocol based on the Bligh and Dyer method, and the trifluoroethanol addition as cosolvent to an aqueous buffer-was performed on white adipose tissue. The performance of the protocols directly compatible with liquid chromatography-electrospray ionization-mass spectrometry (LC-ESI-MS) was evaluated based on the total protein extraction yield and the protein recovery from different functional and cellular compartments. The most suitable method for the extraction of white adipose tissue proteins from a wide range of cellular and structural compartments was the delipidation protocol based on the Bligh and Dye... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852382 Tue, 19 Apr 2011 23:00:00 +0100 4852382 http://www.medworm.com/index.php?rid=4852381&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21565152%26dopt%3DAbstract Authors: Wang YK Preannealed homopolymeric DNAs or RNAs are often used as templates and/or primers to characterize activities of DNA or RNA-dependent RNA polymerases. Based on the calculated melting temperatures (T(m) values), however, poly(A)/oligo(dT(12-18)) is not expected to form stable duplexes. To determine this, we compared the enzymatic activity of hepatitis C virus polymerase using poly(A)/oligo(dT(12)) that were or were not preannealed. No significant differences were observed. These results suggest that it is not necessary to perform preannealing reactions for poly(A) and oligo(dT(12)), making it possible to characterize mechanism of inhibition of NS5B inhibitors against either template RNA poly(A) or primer oligo(dT(12)) independently. PMID: 21565152 [PubMed - as suppli... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852381 Tue, 19 Apr 2011 23:00:00 +0100 4852381 http://www.medworm.com/index.php?rid=4852380&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21569754%26dopt%3DAbstract We describe limitations in the use of 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) to examine unfolding intermediates associated with guanidinium chloride (GuHCl)-induced protein denaturation. Several studies have used alterations in fluorescence emission of bis-ANS to quantify the population of "molten globule" states. Our findings indicate that the observed changes in bis-ANS spectroscopic properties could originate from the interactions of bis-ANS and GuHCl and the aggregation of the dye at higher GuHCl concentrations. We posit that in the absence of additional complementary structural or spectroscopic measurements, the use of bis-ANS emission alone to monitor protein conformations can be misleading. PMID: 21569754 [PubMed - as supplied by publisher] (Source: Analyt... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852380 Tue, 19 Apr 2011 23:00:00 +0100 4852380 http://www.medworm.com/index.php?rid=4852379&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21569755%26dopt%3DAbstract This study demonstrates that RgpB can be used as a specific biomarker for P. gingivalis detection and that the presented nanobody-based assay could supplement existing methods for P. gingivalis detection. PMID: 21569755 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4852379 Tue, 19 Apr 2011 23:00:00 +0100 4852379 http://www.medworm.com/index.php?rid=4798448&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21539804%26dopt%3DAbstract Authors: Kang B, Choi SJ In this work, a phage-displayed peptide library was applied to identification of β-cyclodextrin (CD)-binding peptide tag, capable of being combined to target peptides or proteins in a homogeneous way by established methods such as peptide synthesis and the recombinant DNA technique. Four enriched sequences were obtained after five rounds of biopanning against polymeric β-CD beads. One of the sequences showed high binding affinity to β-CD beads with a dissociation constant of approximately 7×10(-6)M. The β-CD-binding sequence was used for immobilization of a hepatitis C virus (HCV) antigenic peptide on β-CD beads. The functionalized β-CD beads were successfully used for immunoassay of anti-HCV antibody with a detection limit of 1ng. These results demonstr... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798448 Tue, 19 Apr 2011 23:00:00 +0100 4798448 http://www.medworm.com/index.php?rid=4798446&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21545783%26dopt%3DAbstract Authors: Di Bernardo J, Iosco C, Rhoden KJ The sodium/iodide symporter (NIS) is primarily responsible for iodide accumulation in the thyroid gland for the synthesis of thyroid hormones; however, it can also transport other lyotropic anions in the thyroid gland and nonthyroid tissues. Some NIS substrates have important physiological or clinical roles, and others are environmental contaminants with health-related consequences. The aim of this study was to assess the utility of a yellow fluorescent protein variant, YFP-H148Q/I152L, as a biosensor to monitor the cellular uptake of NIS substrates, including thiocyanate (SCN(-)), nitrate (NO(3)(-)), chlorate (ClO(3)(-)), perchlorate (ClO(4)(-)), and perrhenate (ReO(4)(-)). The fluorescence of purified YFP-H148Q/I152L was suppressed by anions... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798446 Tue, 19 Apr 2011 23:00:00 +0100 4798446 http://www.medworm.com/index.php?rid=4798445&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21545784%26dopt%3DAbstract This article describes a microplate-based kinetic assay for mitochondrial NADH- and succinate-cytochrome c reductase activities in rat brain mitochondria. The assay reported here is based on the conventional spectrophotometric method and involves substrate-driven reduction of exogenous cytochrome c. Conditions regarding linearity with respect to time and protein concentration have been standardized. Furthermore, the methods were tested for inhibition of respective activities by specific inhibitors. The microplate format described here can be employed for rapid and simultaneous measurements of mitochondrial NADH- and succinate-cytochrome c reductase activities in a large number of samples. PMID: 21545784 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798445 Tue, 19 Apr 2011 23:00:00 +0100 4798445 http://www.medworm.com/index.php?rid=4798443&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21545786%26dopt%3DAbstract Authors: Giustarini D, Dalle-Donne I, Milzani A, Rossi R The measurement of glutathione is a challenging task in that, during sample manipulation, a large percentage of this compound can be artificially oxidized. Here a high-performance liquid chromatography (HPLC) method to measure reduced glutathione in blood, based on the analysis of its conjugate with N-ethylmaleimide, has been developed and validated. The method is linear in the concentration range 0.1-2mM, and the lower limit of quantification is 0.05mM. Blood samples treated with N-ethylmaleimide are stable at -20°C for 90days. This method has simplicity and rapidity as its main advantages; therefore, it is particularly suitable for large-scale clinical studies. PMID: 21545786 [PubMed - as supplied by publisher] (Source: An... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798443 Tue, 19 Apr 2011 23:00:00 +0100 4798443 http://www.medworm.com/index.php?rid=4798442&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21545787%26dopt%3DAbstract Authors: An Y, Cipollo JF Here a mass spectrometry-based platform for the analysis of glycoproteins is presented. Glycopeptides and released glycans are analyzed, the former by quadrupole orthogonal time-of-flight liquid chromatography/mass spectrometry (QoTOF LC/MS) and the latter by permethylation analysis using matrix-assisted laser desorption/ionization (MALDI)-TOF MS. QoTOF LC/MS analysis reveals the stochastic distribution of glycoforms at occupied sequons, and the latter provides a semiquantitative assessment of overall protein glycosylation. Hydrophilic interaction chromatography (HILIC) was used for unbiased enrichment of glycopeptides and was validated using five model N-glycoproteins bearing a wide array of glycans, including high-mannose, complex, and hybrid subtypes such a... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798442 Tue, 19 Apr 2011 23:00:00 +0100 4798442 http://www.medworm.com/index.php?rid=4798449&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21536013%26dopt%3DAbstract Authors: Han H, Yoon JK, Cho BC, Kim H, Bang D Here we present multiple target loci assembly sequencing (mTAS), a method for examining multiple genomic loci in a single DNA sequencing read. The key to the success of mTAS target sequencing is the uniform amplification of multiple target genomic loci into a single DNA fragment using polymerase cycling assembly (PCA). Using this strategy, we successfully collected multiloci sequence information from a single DNA sequencing run. We applied mTAS to examine 29 different sets of human genomic loci, each containing from 2 to 11 single-nucleotide polymorphisms (SNP) present at different exons. We believe mTAS can be used to reduce the cost of Sanger sequencing-based genetic analysis. PMID: 21536013 [PubMed - as supplied by publisher] (Sourc... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798449 Fri, 15 Apr 2011 23:00:00 +0100 4798449 http://www.medworm.com/index.php?rid=4798447&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21539805%26dopt%3DAbstract Authors: Kumari P, Reddy CR, Jha B A comparative evaluation of Bligh and Dyer, Folch, and Cequier-Sánchez methods for quantitative determination of total lipids (TLs) and fatty acids (FAs) was accomplished in selective green (Ulva lactuca), red (Gracilaria corticata), and brown algae (Sargassum tenerrimum) using a full factorial categorical design. Applications of sonication and buffer individually on lipid extraction solvent systems were also evaluated. The FA recoveries obtained from the aforementioned methods were compared with those of direct transesterification (DT) methods to identify the best extraction methods. The experimental design showed that macroalgal matrix, extraction method, and buffer were key determinants for TL and FA recoveries (P⩽0.05), exhibiting significant i... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798447 Fri, 15 Apr 2011 23:00:00 +0100 4798447 http://www.medworm.com/index.php?rid=4798444&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21545785%26dopt%3DAbstract Authors: Duane Smith M, Collins RA Several ribozymes are active in molar concentrations of monovalent salts, and pH rate curves under such conditions are consistent with mechanisms involving general acid-base catalysis. Interpreting the apparent pK(a) values requires an accurate estimation of solution pH, which can be difficult to obtain using a typical glass pH electrode in the presence of high salt concentrations. In the current work we have used the VS ribozyme as a "biological pH meter" to evaluate the effects of molar concentrations of monovalent salts on changes in solution pH. We find that almost all of the measured change in pH observed in high concentrations of LiCl is due to a real change in solution pH. In contrast, high concentrations of NaCl cause errors in pH measurement ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798444 Fri, 15 Apr 2011 23:00:00 +0100 4798444 http://www.medworm.com/index.php?rid=4798455&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21530478%26dopt%3DAbstract We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. PMID: 21530478 [PubMed - as supplied by publisher] (Source: Analytical Biochemistry) Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798455 Thu, 14 Apr 2011 23:00:00 +0100 4798455 http://www.medworm.com/index.php?rid=4798454&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21530479%26dopt%3DAbstract Authors: Song KM, Cho M, Jo H, Min K, Jeon SH, Kim T, Han MS, Ku JK, Ban C A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8nM, K(d) [kanamycin B]=84.5nM, and K(d) [tobramycin]=103nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, eas... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798454 Thu, 14 Apr 2011 23:00:00 +0100 4798454 http://www.medworm.com/index.php?rid=4798453&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21530480%26dopt%3DAbstract Authors: Pugniere P, Banzet S, Chaillou T, Mouret C, Peinnequin A A large part of the reliability of reverse transcription quantitative polymerase chain reaction (RT-qPCR) data depends on technical variations. Such variations are mainly attributable to the reverse transcription step. Standardization is a key factor in decreasing the intersample variability. However, an ideal standardization is not always possible, and compromises must be found. Due to technical requirements, the current consensus is that a constant amount of total RNA should be used for the RT step (CA-RT). Because RNA isolation yields are variable, such a practice requires the use of variable volumes of nucleic acid extracts in RT reaction. We demonstrate that some RNA extracts contain both exogenous and endogenous in... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798453 Thu, 14 Apr 2011 23:00:00 +0100 4798453 http://www.medworm.com/index.php?rid=4798452&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21530481%26dopt%3DAbstract Authors: Mao Y, Lin J, Zhou A, Ji K, Downey JS, Chen R, Han A Gene synthesis is a convenient tool that is widely used to make genes for a variety of purposes. All current protocols essentially take inside-out approaches to assemble complete genes using DNA oligonucleotides or intermediate fragments. Here we present an efficient method that integrates gene synthesis and cloning into one step. Our method, which is evolved from QuikChange mutagenesis, can modify, extend, or even de novo synthesize relatively large genes. The genes are inserted directly into vectors without ligations or subcloning. We de novo synthesized a 600-bp gene through multiple steps of polymerase chain reaction (PCR) directly into a bacterial expression vector. This outside-in gene synthesis method is called Quikge... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798452 Thu, 14 Apr 2011 23:00:00 +0100 4798452 http://www.medworm.com/index.php?rid=4798451&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21530482%26dopt%3DAbstract Authors: Yang B, Weyers A, Baik JY, Sterner E, Sharfstein S, Mousa SA, Zhang F, Dordick JS, Linhardt RJ A high-resolution method for the separation and analysis of disaccharides prepared from heparin and heparan sulfate (HS) using heparin lyases is described. Ultra-performance liquid chromatography in a reverse-phase ion-pairing mode efficiently separates eight heparin/HS disaccharides. The disaccharides can then be detected and quantified using electrospray ionization mass spectrometry. This method is particularly useful in the analysis of small amounts of biological samples, including cells, tissues, and biological fluids, because it provides high sensitivity without being subject to interference from proteins, peptides, and other sample impurities. PMID: 21530482 [PubMed - as su... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798451 Thu, 14 Apr 2011 23:00:00 +0100 4798451 http://www.medworm.com/index.php?rid=4798450&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21531198%26dopt%3DAbstract Authors: Calderón-Santiago M, Mata-Granados JM, Priego-Capote F, Quesada-Gómez JM, Castro MD A selective and sensitive, fully automated platform for verification and quantitative determination of target peptides in biofluids is proposed and then validated by development of a method for analysis of cathelicidin in human serum. The method is based on the on-line coupling of solid-phase extraction (SPE) and tandem mass spectrometry with direct infusion. Mass spectrometry analysis was carried out by multiple reaction monitoring using three transitions (one for quantitative analysis and two for qualitative analysis), all them confirmed by in silico fragmentation of the target peptide. Samples were prepared in the SPE workstation on a polymeric divinylbenzene resin by preconcentration, dep... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798450 Thu, 14 Apr 2011 23:00:00 +0100 4798450 http://www.medworm.com/index.php?rid=4798457&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21477577%26dopt%3DAbstract Authors: Huang X, Hernick M Here we report a new fluorescence-based assay for measuring MshB (N-acetyl-1-d-myo-inosityl-2-amino-2-deoxy-α-d-glucopyranoside deacetylase) activity. The current assay for measuring MshB activity requires the fluorescent labeling of reaction mixtures and subsequent analysis using high-performance liquid chromatography (HPLC), resulting in a significant amount of processing time per sample. Here we describe a more rapid fluorescnce-based assay for the measurement of MshB activity that does not require HPLC analysis and can be carried out in multiwell plates. This fluorescamine (FSA)-based assay was used to determine the steady-state parameters for the deacetylation of N-acetyl-glucosamine (GlcNAc) by MshB, and the results from these experiments support the ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798457 Tue, 05 Apr 2011 23:00:00 +0100 4798457 http://www.medworm.com/index.php?rid=4798456&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21477578%26dopt%3DAbstract Authors: Huttunen R, Shweta , Martikkala E, Lahdenranta M, Virta P, Hänninen P, Härmä H Homogeneous luminescence-based microplate assays are desirable in high-throughput screening of new nuclear receptor regulators. Time-resolved fluorescence resonance energy transfer (TR-FRET) assays provide high sensitivity due to low background signal. TR-FRET concept requires labeling of both ligand and receptor making the assay format and its development relatively expensive and complex compared to single-label methods. To overcome the limitations of the multilabel methods we have developed a single-label method for estrogen receptor (ER) ligand binding based on the quenching resonance energy transfer (QRET) where estradiol labeled with luminescent europium(III) chelate (Eu-E(2)) is quenched us... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798456 Mon, 04 Apr 2011 23:00:00 +0100 4798456 http://www.medworm.com/index.php?rid=4798459&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21459075%26dopt%3DAbstract Authors: Iizuka R, Yamagishi-Shirasaki M, Funatsu T Green fluorescent protein (GFP) has a chromophore that forms autocatalytically within the folded protein. Although many studies have focused on the precise mechanism of chromophore maturation, little is known about the kinetics of de novo chromophore maturation. Here we present a simple and efficient method for examining the de novo kinetics. GFP with an immature chromophore was synthesized in a reconstituted cell-free protein synthesis system under anaerobic conditions. Chromophore maturation was initiated by rapid dilution in an air-saturated maturation buffer, and the time course of fluorescence development was monitored. Comparison of the de novo maturation rates in various GFP variants revealed that some folding mutations near th... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798459 Thu, 31 Mar 2011 23:00:00 +0100 4798459 http://www.medworm.com/index.php?rid=4798458&cid=s_34389_60_f&fid=34389&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21459076%26dopt%3DAbstract Authors: Jiang Y, Schneck JL, Grimes M, Taylor AN, Hou W, Thrall SH, Sweitzer SM Epigenetics is an area of increasing interest for drug discovery, driving the need for assays that use nucleosome substrates. Our studies showed that SUV39H1, a histone lysine methyltransferase, and Dnmt3b/Dnmt3L, a DNA methyltransferase, both exhibited approximately five times more activity on monomer nucleosomes than on DNA-core-trimmed nucleosomes in a scintillation proximity assay (SPA). The methyltransferases recognize and have a preference for nucleosomes with longer DNA strands. Our findings suggest that the use of monomer nucleosomes as substrates using SPA technology could lead to more robust screening assays and potentially more specific small molecule inhibitors of epigenetic enzymes. PMID: ... Analytical Biochemistry journals http://www.medworm.com/rss/comments.php?id=4798458 Thu, 31 Mar 2011 23:00:00 +0100 4798458