MedWorm.com provides a medical RSS filtering service. Over 6000 RSS medical sources are combined and output via different filters. This feed contains the latest items from the 'Chromosome Research' source. Thu, 09 Feb 2012 09:43:30 +0100 http://www.medworm.com/index.php?rid=5649181&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22290220%26dopt%3DAbstract Authors: Eggers S, Sinclair A Abstract Disorders of sex development (DSD) are congenital conditions in which the development of chromosomal, gonadal, or anatomical sex is atypical. Many of the genes required for gonad development have been identified by analysis of DSD patients. However, the use of knockout and transgenic mouse strains have contributed enormously to the study of gonad gene function and interactions within the development network. Although the genetic basis of mammalian sex determination and differentiation has advanced considerably in recent years, a majority of 46,XY gonadal dysgenesis patients still cannot be provided with an accurate diagnosis. Some of these unexplained DSD cases may be due to mutations in novel DSD genes or genomic rearrangements affecting regu... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5649181 Tue, 31 Jan 2012 05:00:00 +0100 5649181 http://www.medworm.com/index.php?rid=5635381&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22274548%26dopt%3DAbstract Authors: Sciurano RB, Rahn MI, Rossi L, Luaces JP, Merani MS, Solari AJ Abstract Three xenarthrans species Chaetophractus villosus, Chaetophractus vellerosus, and Zaedyus pichiy have been used for the analysis of the structure, behavior, and immunochemical features of the XY body during pachytene. In all these species, the sex chromosomes form an XY body easily identifiable in thin sections by the special and regular packing of the chromatin fibers of the internal region of the XY body ("differential" regions) and those of the peripheral region (synaptic region). Spermatocyte spreads show a complete synapsis between the X- and the Y-axis, which lasts up to the end of pachytene. From the early pachytene substages to the late ones, the X-axis develops prominent branches, which in lat... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5635381 Wed, 25 Jan 2012 05:00:00 +0100 5635381 http://www.medworm.com/index.php?rid=5635380&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22274549%26dopt%3DAbstract Authors: Ezaz T, Graves JA PMID: 22274549 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5635380 Wed, 25 Jan 2012 05:00:00 +0100 5635380 http://www.medworm.com/index.php?rid=5593326&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22234547%26dopt%3DAbstract Authors: Cabral-de-Mello DC, Valente GT, Nakajima RT, Martins C Abstract To better understand genomic and chromosomal organization and evolutionary patterns of the U1 snRNA gene in cichlid fish, the gene was cytogenetically mapped and comparatively analyzed in 19 species belonging to several clades of the group. Moreover, the distribution and organization of U1 snRNA gene was analyzed in the Oreochromis niloticus genome. The results indicated high conservation of one chromosomal cluster of U1 snRNA in the African, Asian, and South American species, with few variations in the chromosomal position of the clusters in the South American species. The genomic analysis of U1 revealed a distinct scenario from that observed under the cytogenetic mapping. An enrichment of the U1 gene on link... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5593326 Wed, 11 Jan 2012 05:00:00 +0100 5593326 http://www.medworm.com/index.php?rid=5593327&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22231503%26dopt%3DAbstract Authors: Vasco C, Manterola M, Page J, Zuccotti M, de la Fuente R, Redi CA, Fernandez-Donoso R, Garagna S Abstract The house mouse is characterised by highly variable chromosome number due to the presence of Robertsonian (Rb) chromosomes. During meiosis in Rb heterozygotes, intricated chromosomal figures are produced, and many unsynapsed regions are present during the first prophase, triggering a meiotic silencing of unsynapsed chromatin (MSUC) in a similar mode to the sex chromosome inactivation. The presence of unsynapsed chromosome regions is associated with impaired spermatogenesis. Interestingly, in male mice carrying multiple Rb trivalents, the frequency of germ cell death, defective tubules, and altered sperm morphology decreases during aging. Here, we studied whether synaps... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5593327 Tue, 10 Jan 2012 05:00:00 +0100 5593327 http://www.medworm.com/index.php?rid=5573336&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22218935%26dopt%3DAbstract Authors: O'Meally D, Ezaz T, Georges A, Sarre SD, Graves JA Abstract Several recent studies have produced comparative maps of genes on amniote sex chromosomes, revealing homology of gene content and arrangement across lineages as divergent as mammals and lizards. For example, the chicken Z chromosome, which shares homology with the sex chromosomes of all birds, monotremes, and a gecko, is a striking example of stability of genome organization and retention, or independent acquisition, of function in sex determination. In other lineages, such as snakes and therian mammals, well conserved but independently evolved sex chromosome systems have arisen. Among lizards, novel sex chromosomes appear frequently, even in congeneric species. Here, we review recent gene mapping data, examine th... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5573336 Thu, 05 Jan 2012 05:00:00 +0100 5573336 http://www.medworm.com/index.php?rid=5573338&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22215485%26dopt%3DAbstract Authors: Bagheri-Fam S, Sreenivasan R, Bernard P, Knower KC, Sekido R, Lovell-Badge R, Just W, Harley VR Abstract In most mammals, the Y chromosomal Sry gene initiates testis formation within the bipotential gonad, resulting in male development. SRY is a transcription factor and together with SF1 it directly up-regulates the expression of the pivotal sex-determining gene Sox9 via a 1.3-kb cis-regulatory element (TESCO) which contains an evolutionarily conserved region (ECR) of 180 bp. Remarkably, several rodent species appear to determine sex in the absence of Sry and a Y chromosome, including the mole voles Ellobius lutescens and Ellobius tancrei, whereas Ellobius fuscocapillus of the same genus retained Sry. The sex-determining mechanisms in the Sry-negative species remain elusi... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5573338 Wed, 04 Jan 2012 05:00:00 +0100 5573338 http://www.medworm.com/index.php?rid=5573337&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22215486%26dopt%3DAbstract Authors: Tsend-Ayush E, Kortschak RD, Bernard P, Lim SL, Ryan J, Rosenkranz R, Borodina T, Dohm JC, Himmelbauer H, Harley VR, Grützner F Abstract The basal lineage of monotremes features an extraordinarily complex sex chromosome system which has provided novel insights into the evolution of mammalian sex chromosomes. Recently, sequence information from autosomes, X chromosomes, and XY-shared pseudoautosomal regions has become available. However, no gene has so far been described on any of the Y chromosome-specific regions. We analyzed sequences derived from Y-specific BAC clones to identify genes with potentially male-specific function. Here, we report the identification and characterization of the mediator complex protein gametologs on platypus Y5 (Crspy). We also identified the ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5573337 Wed, 04 Jan 2012 05:00:00 +0100 5573337 http://www.medworm.com/index.php?rid=5543552&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22198613%26dopt%3DAbstract Authors: Murata C, Yamada F, Kawauchi N, Matsuda Y, Kuroiwa A Abstract The genus Tokudaia comprises three species, two of which have lost their Y chromosome and have an XO/XO sex chromosome constitution. Although Tokudaia muenninki (Okinawa spiny rat) retains the Y chromosome, both sex chromosomes are unusually large. We conducted a molecular cytogenetic analysis to characterize the sex chromosomes of T. muenninki. Using cross-species fluorescence in situ hybridization (Zoo-FISH), we found that both short arms of the T. muenninki sex chromosomes were painted by probes from mouse chromosomes 11 and 16. Comparative genomic hybridization analysis was unable to detect sex-specific regions in the sex chromosomes because both sex probes highlighted the large heterochromatic blocks on the... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5543552 Sat, 24 Dec 2011 05:00:00 +0100 5543552 http://www.medworm.com/index.php?rid=5543554&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22187366%26dopt%3DAbstract Authors: Sahara K, Yoshido A, Traut W Abstract Lepidoptera, i.e. moths and butterflies, have a female heterogametic sex chromosome system, with most females having a WZ constitution while males are ZZ. Besides this predominant WZ/ZZ system, Z/ZZ, WZ(1)Z(2)/Z(1)Z(1)Z(2)Z(2) and W(1)W(2)Z/ZZ systems also occur. Sex is determined by an unknown W-linked gene or genes in Bombyx mori, but by dosage-dependent and equally unknown Z-linked genes in all Z/ZZ species. The female heterogametic sex chromosome system has been conserved for at least 180 MY in the phylogenetic branch that combines Lepidoptera and Trichoptera. The W chromosome, which is present in most lepidopteran species, was incorporated in the sex chromosome system much later, about 90-100 MY ago. The Z chromosomes are highly... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5543554 Wed, 21 Dec 2011 05:00:00 +0100 5543554 http://www.medworm.com/index.php?rid=5543553&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22187367%26dopt%3DAbstract Authors: Masuyama H, Yamada M, Kamei Y, Fujiwara-Ishikawa T, Todo T, Nagahama Y, Matsuda M Abstract DMRT1, which is found in many vertebrates, exhibits testis-specific expression during the sexual differentiation period, suggesting a conserved function of DMRT1 in the testicular development of vertebrate gonads. However, functional analyses have been reported only in mammals. The current study focused on the Dmrt1 function in the teleost medaka, Oryzias latipes, which has an XX-XY sex determination system. Although medaka sex is determined by the presence or absence of the Y chromosome-specific gene Dmy, we demonstrated that in one Dmrt1 mutant line, which was found by screening a gene-driven mutagenesis library, XY mutants developed into normal females and laid eggs. Histological ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5543553 Wed, 21 Dec 2011 05:00:00 +0100 5543553 http://www.medworm.com/index.php?rid=5523234&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22183803%26dopt%3DAbstract Authors: Kawagoshi T, Nishida C, Matsuda Y Abstract The black marsh turtle (Siebenrockiella crassicollis) has morphologically differentiated X and Y sex chromosomes. To elucidate the origin and evolutionary process of S. crassicollis X and Y chromosomes, we performed cross-species chromosome painting with chromosome-specific DNA from Chinese soft-shelled turtle (Pelodiscus sinensis) and chromosome mapping of the sex-linked genes of S. crassicollis using FISH. The X and Y chromosomes of S. crassicollis were hybridized with DNA probe of P. sinensis chromosome 5, which is homologous to chicken chromosome 5. S. crassicollis homologues of 14 chicken chromosome 5-linked genes were all localized to the X long arm, whereas two genes were mapped to the Y short arm and the other 12 genes wer... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5523234 Tue, 20 Dec 2011 05:00:00 +0100 5523234 http://www.medworm.com/index.php?rid=5523235&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22167552%26dopt%3DAbstract Authors: Mawaribuchi S, Yoshimoto S, Ohashi S, Takamatsu N, Ito M Abstract Y-linked Dmy (also called dmrt1bY) in the teleost fish medaka, W-linked Dm-W in the African clawed frog (Xenopus laevis), and Z-linked Dmrt1 in the chicken are all sex chromosome-linked Dmrt1 homologues required for sex determination. Dmy and Dm-W both are Dmrt1 palalogues evolved through Dmrt1 duplication, while chicken Dmrt1 is a Z-linked orthologue. The eutherian sex-determining gene, Sry, evolved from an allelic gene, Sox3. Here we analyzed the exon-intron structures of the Dmrt1 homologues of several vertebrate species through information from databases and by determining the transcription initiation sites in medaka, chicken, Xenopus, and mouse. Interestingly, medaka Dmrt1 and Dmy and Xenopus Dm-W and D... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5523235 Wed, 14 Dec 2011 05:00:00 +0100 5523235 http://www.medworm.com/index.php?rid=5523239&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22161017%26dopt%3DAbstract In this study, we use electron and immunofluorescent microscopy to assess heterogametic sex chromosome pairing in 12 additional arvicoline species. Our sample includes ten species of the tribe Microtini and two species of the tribe Lagurini. This increased breadth of sampling allowed us to identify asynaptic species in each major Microtine lineage. Evidently, the ability of the sex chromosomes to pair and recombine in male meiosis has been independently lost at least three times during the evolution of Microtine rodents. These results suggest a lack of evolutionary constraint on X-Y synapsis in Microtini, hinting at the presence of alternative molecular mechanisms for sex chromosome segregation in this large mammalian tribe. PMID: 22161017 [PubMed - as supplied by publisher] (Source: C... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5523239 Tue, 13 Dec 2011 05:00:00 +0100 5523239 http://www.medworm.com/index.php?rid=5523238&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22161018%26dopt%3DAbstract Authors: Cutting AD, Bannister SC, Doran TJ, Sinclair AH, Tizard MV, Smith CA Abstract Differential gene expression regulates tissue morphogenesis. The embryonic gonad is a good example, where the developmental decision to become an ovary or testis is governed by female- or male-specific gene expression. A number of genes have now been identified that control gonadal sex differentiation. However, the potential role of microRNAs (miRNAs) in ovarian and testicular pathways is unknown. In this review, we summarise our current understanding of gonadal differentiation and the possible involvement of miRNAs, using the chicken embryo as a model system. Chickens and other birds have a ZZ/ZW sex chromosome system, in which the female, ZW, is the heterogametic sex, and the male, ZZ, is homog... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5523238 Tue, 13 Dec 2011 05:00:00 +0100 5523238 http://www.medworm.com/index.php?rid=5523237&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22161124%26dopt%3DAbstract Authors: Zhao L, Koopman P Abstract Even though the mammalian sex-determining gene Sry has been intensively studied for the two decades since its discovery, the regions outside the conserved HMG box DNA-binding domain have received less attention due to a lack of sequence conservation and of obvious structural/functional motifs. Here, we summarize the available evidence for function beyond the HMG box, identify the known and postulated biochemical functions of the non-HMG-box domains in sex determination, and present possible explanations for the puzzling diversity of these non-HMG-box domains. PMID: 22161124 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5523237 Thu, 08 Dec 2011 05:00:00 +0100 5523237 http://www.medworm.com/index.php?rid=5523236&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22161125%26dopt%3DAbstract Authors: Pask AJ Abstract Estrogen is both necessary and sufficient to drive ovarian development in many nonmammalian vertebrates. However, the role of estrogen in the mammalian gonad is less clear. Mouse ovarian development can proceed in the absence of estrogen signaling, but granulosa cell fate cannot be maintained. Estrogen receptor expression is conserved in the indifferent gonad of all mammals and many species also express the CYP19 gene that encodes aromatase, in the early ovary. Furthermore, estrogen is sufficient to drive ovarian development of the indifferent gonad in marsupial mammals. Here we review the function of estrogen in the mammalian gonad and propose a model for its action in establishing and maintaining ovarian somatic cell fate. PMID: 22161125 [PubMed - as... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5523236 Thu, 08 Dec 2011 05:00:00 +0100 5523236 http://www.medworm.com/index.php?rid=5523240&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22143254%26dopt%3DAbstract Authors: Miura I, Ohtani H, Ogata M Abstract The frog Rana rugosa uniquely possesses two different sex-determining systems of XX/XY and ZZ/ZW, separately in the geographic populations. The sex chromosomes of both types share the same origin at chromosome 7, and the structural differences between X and Y or Z and W were evolved through two inversions. In order to ascertain the mechanisms of degeneration of W and Y chromosomes, we gynogenetically produced homozygous diploids WW and YY and examined their viability. Tadpoles from geographic group N (W(N)W(N)) containing three populations died of edema at an early developmental stage within 10 days after hatching, while tadpoles from the geographic group K (W(K)W(K)) that contained two populations died of underdeveloped growth at a muc... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5523240 Tue, 06 Dec 2011 05:00:00 +0100 5523240 http://www.medworm.com/index.php?rid=5468999&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22124858%26dopt%3DAbstract Authors: Clinton M, Zhao D, Nandi S, McBride D Abstract For the majority of animals, males and females are obviously different in terms of appearance, behaviour and physiology, and until recently, these differences were considered to be the result of hormone actions. However, there is now considerable evidence that the development of some sexually dimorphic structures/behaviours is a function of properties inherent to male and female cells (hormone independent). The relative contribution of hormones and cellular identity to the development of the phenotype is not clear and is likely to vary from species to species. The study of gynandromorph birds and chimeric embryos has greatly assisted efforts to distinguish between the effects of hormones and inherent cellular factors on phenot... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5468999 Tue, 29 Nov 2011 05:00:00 +0100 5468999 http://www.medworm.com/index.php?rid=5468998&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22124859%26dopt%3DAbstract In this study, a novel family of repetitive sequence was molecularly cloned from O. hubbsi and characterized by chromosome in situ and filter hybridization, respectively. This repetitive element, which we designated as a BstNI family element, localized at heterochromatin regions on the W chromosome, as well as on two pairs of autosomes. Homologous sequences to this element were found only in O. javanicus, which is a sister species of O. hubbsi, suggesting that this repeated element originated in the common ancestor of these two species. However, the intensity of the hybridization signals was lower in O. javanicus than in O. hubbsi, and the chromosomal location of this element in O. javanicus was confined to heterochromatin regions on one pair of autosomes. Thus, we hypothesize that this re... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5468998 Tue, 29 Nov 2011 05:00:00 +0100 5468998 http://www.medworm.com/index.php?rid=5469001&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22105695%26dopt%3DAbstract Authors: Franco HL, Yao HH Abstract The chromosome status of the mammalian embryo initiates a multistage process of sexual development in which the bipotential reproductive system establishes itself as either male or female. These events are governed by intricate cell-cell and interorgan communication that is regulated by multiple signaling pathways. The hedgehog signaling pathway was originally identified for its key role in the development of Drosophila, but is now recognized as a critical developmental regulator in many species, including humans. In addition to its developmental roles, the hedgehog signaling pathway also modulates adult organ function, and misregulation of this pathway often leads to diseases, such as cancer. The hedgehog signaling pathway acts through its morph... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5469001 Tue, 22 Nov 2011 05:00:00 +0100 5469001 http://www.medworm.com/index.php?rid=5469000&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22105696%26dopt%3DAbstract Authors: Gschwend AR, Weingartner LA, Moore RC, Ming R Abstract Our understanding of the evolution of sex chromosomes has increased greatly in recent years due to a number of molecular evolutionary investigations in divergent sex chromosome systems, and these findings are reshaping theories of sex chromosome evolution. In particular, the dynamics of the sex-determining region (SDR) have been demonstrated by recent findings in ancient and incipient sex chromosomes. Radical changes in genomic structure and gene content in the male specific region of the Y chromosome between human and chimpanzee indicated rapid evolution in the past 6 million years, defying the notion that the pace of evolution in the SDR was fast at early stages but slowed down overtime. The chicken Z and the human X... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5469000 Tue, 22 Nov 2011 05:00:00 +0100 5469000 http://www.medworm.com/index.php?rid=5406752&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22083302%26dopt%3DAbstract Authors: Griffin DK Abstract On August 31, 2011 at the 18th International Chromosome Conference in Manchester, Jenny Graves took on Jenn Hughes to debate the demise (or otherwise) of the mammalian Y chromosome. Sex chromosome evolution is an example of convergence; there are numerous examples of XY and ZW systems with varying degrees of differentiation and isolated examples of the Y disappearing in some lineages. It is agreed that the Y was once genetically identical to its partner and that the present-day human sex chromosomes retain only traces of their shared ancestry. The euchromatic portion of the male-specific region of the Y is ~1/6 of the size of the X and has only ~1/12 the number of genes. The big question however is whether this degradation will continue or whether it ha... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5406752 Tue, 15 Nov 2011 05:00:00 +0100 5406752 http://www.medworm.com/index.php?rid=5406751&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22083303%26dopt%3DAbstract We describe here a unique chromosome-tracking system that differentially marks two large chromosome segments from homologs in the budding yeast Saccharomyces cerevisiae. Using yeast genetics and the special features at the repetitive ribosomal RNA (rRNA) gene cluster, we incorporated arrays of the tet operator and the lac operator into each repeat of the two rDNA homologs by homologous recombination. Expression of tet repressor-fused green fluorescent protein and lac repressor-fused red fluorescent protein in engineered cells led to the differential labeling of rDNA homologs. Using live-cell three-dimensional fluorescence microscopy, we showed that homologs undergo contraction and expansion cycles in an actin-dependent manner during meiosis and that chromosome mobility appears to be correl... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5406751 Tue, 15 Nov 2011 05:00:00 +0100 5406751 http://www.medworm.com/index.php?rid=5406753&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22076608%26dopt%3DAbstract Authors: Borowska N, Idziak D, Hasterok R Abstract Sequential immunolocalisation of 5-methylcytosine (5-MeC) and fluorescence in situ hybridisation with chromosome-specific BAC clones were performed on Brachypodium distachyon mitotic metaphase chromosomes to determine specific DNA methylation patterns of each chromosome in the complement. In the majority of cells examined, chromosomes Bd4 and Bd5, which bear the loci of 5S and 35S ribosomal DNA, respectively, had characteristic 5-MeC patterns. In contrast, the distribution of 5-MeC along the metacentric chromosome pairs Bd1, Bd2 and Bd3 was more variable. There were numerous differences in distribution of methylated sites between homologous chromosomes as well as between chromosome arms. Some chromosome sites, such as pericentromer... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5406753 Fri, 11 Nov 2011 05:00:00 +0100 5406753 http://www.medworm.com/index.php?rid=5406754&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22065151%26dopt%3DAbstract Authors: Tek AL, Kashihara K, Murata M, Nagaki K Abstract The centromere plays an essential role for proper chromosome segregation during cell division and usually harbors long arrays of tandem repeated satellite DNA sequences. Although this function is conserved among eukaryotes, the sequences of centromeric DNA repeats are variable. Most of our understanding of functional centromeres, which are defined by localization of a centromere-specific histone H3 (CENH3) protein, comes from model organisms. The components of the functional centromere in legumes are poorly known. The genus Astragalus is a member of the legumes and bears the largest numbers of species among angiosperms. Therefore, we studied the components of centromeres in Astragalus sinicus. We identified the CenH3 homolog... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5406754 Tue, 08 Nov 2011 05:00:00 +0100 5406754 http://www.medworm.com/index.php?rid=5371431&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22042526%26dopt%3DAbstract Authors: Dufresne F, Jeffery N Abstract The study of genome size diversity is an ever-expanding field that is highly relevant in today's world of rapid and efficient DNA sequencing. Animal genome sizes range from 0.02 to 132.83 pg but the majority of animal genomes are small, with the most of these genome sizes being less than 5 pg. Animals with large genomes (>10 pg) are scattered within some invertebrates, including the Platyhelminthes, crustaceans, and orthopterans, and also the vertebrates including the Actinopterygii, Chondrichthyes, and some amphibians. In this paper, we explore the connections between organismal phenotype, physiology, and ecology to genome size. We also discuss some of the molecular mechanisms of genome shrinkage and expansion obtained through comparat... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5371431 Tue, 01 Nov 2011 04:00:00 +0100 5371431 http://www.medworm.com/index.php?rid=5371433&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22038284%26dopt%3DAbstract Authors: Yokota E, Shibata F, Nagaki K, Murata M Abstract A dicentric ring minichromosome (miniδ) was identified in transgenic Arabidopsis thaliana and added to a wild type as a supernumerary chromosome. This line is relatively stable and has been maintained for generations, notwithstanding its ring and dicentric structure. To determine the mechanism for stable transmission of miniδ, the structure and behavior of two new types of ring minichromosomes (miniδ1 and miniδ1-1) derived from miniδ were investigated. Fluorescence in situ hybridization analysis revealed that miniδ1 is dicentric just like miniδ, whereas miniδ1-1 is monocentric. The estimated sizes of miniδ1 and miniδ1-1 were 3.8~5.0 and 1.7 Mb, respectively. The sizes of the two centromeres on miniδ1 were identic... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5371433 Sat, 29 Oct 2011 04:00:00 +0100 5371433 http://www.medworm.com/index.php?rid=5371432&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22038285%26dopt%3DAbstract Authors: Mank JE Abstract Although sex chromosomes have been the focus of a great deal of scientific scrutiny, most interest has centred on understanding the evolution and relative importance of X and Z chromosomes. By contrast, the sex-limited W and Y chromosomes have received far less attention, both because of their generally degenerate nature and the difficulty in studying non-recombining and often highly heterochromatic genomic regions. However, recent theory and empirical evidence suggest that the W and Y chromosomes play a far more important role in sex-specific fitness traits than would be expected based on their size alone, and this importance may explain the persistence of some Y and W chromosomes in the face of powerful degradative forces. In addition to their role in fe... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5371432 Sat, 29 Oct 2011 04:00:00 +0100 5371432 http://www.medworm.com/index.php?rid=5371434&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22033805%26dopt%3DAbstract Authors: Kress C, Kiêu K, Droineau S, Galio L, Devinoy E Abstract The nuclear organization of mammary epithelial cells has been shown to be sensitive to the three-dimensional microenvironment in several models of cultured cells. However, the relationships between the expression and position of genes have not often been explored in animal tissues. We therefore studied the localization of milk protein genes in the nuclei of luminal mammary epithelial cells during lactation as well as in two non-expressing cells, i.e., hepatocytes and the less differentiated embryonic fibroblasts. We compared the position of a cluster of co-regulated genes, encoding caseins (CSN), with that of the whey acidic protein (WAP) gene which is surrounded by genes displaying different expression profiles. We... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5371434 Thu, 27 Oct 2011 04:00:00 +0100 5371434 http://www.medworm.com/index.php?rid=5371435&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22009222%26dopt%3DAbstract Authors: Chen Q, Shi X, Rudolph C, Yu Y, Zhang D, Zhao X, Mai S, Wang G, Schlegelberger B, Shi Q Abstract Induced pluripotent stem (iPS) cells have greatly provoked people's interest due to their enormous potential of clinical applications. Increasing care is taken with the genetic safety of iPS cells. However, up to now, the chromosomal integrity of murine iPS (miPS) cells has been largely unknown. We have observed recurrent trisomy and/or Robertsonian translocation (Rb) of chromosome 14 in six out of nine independent miPS cell lines from three laboratories by G-banding, fluorescence in situ hybridization (FISH) and spectral karyotyping (SKY) analyses, while all the miPS cell lines were derived from mouse embryonic fibroblasts (MEFs) or neural precursor cells (NPCs) with a normal ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5371435 Wed, 19 Oct 2011 04:00:00 +0100 5371435 http://www.medworm.com/index.php?rid=5371436&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D22006037%26dopt%3DAbstract Authors: Boyle S, Rodesch MJ, Halvensleben HA, Jeddeloh JA, Bickmore WA Abstract The ability to visualize specific DNA sequences, on chromosomes and in nuclei, by fluorescence in situ hybridization (FISH) is fundamental to many aspects of genetics, genomics and cell biology. Probe selection is currently limited by the availability of DNA clones or the appropriate pool of DNA sequences for PCR amplification. Here, we show that liquid-phase probe pools from sequence capture technology can be adapted to generate fluorescently labelled pools of oligonucleotides that are very effective as repeat-free FISH probes in mammalian cells. As well as detection of small (15 kb) and larger (100 kb) specific loci in both cultured cells and tissue sections, we show that complex oligonucleotide po... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5371436 Tue, 18 Oct 2011 04:00:00 +0100 5371436 http://www.medworm.com/index.php?rid=5323186&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21987185%26dopt%3DAbstract Authors: Trifonov VA, Giovannotti M, O'Brien PC, Wallduck M, Lovell F, Rens W, Parise-Maltempi PP, Caputo V, Ferguson-Smith MA Abstract Geckos are a large group of lizards characterized by a rich variety of species, different modes of sex determination and diverse karyotypes. In spite of many unresolved questions on lizards' phylogeny and taxonomy, the karyotypes of most geckos have been studied by conventional cytogenetic methods only. We used flow-sorted chromosome-specific painting probes of Japanese gecko (Gekko japonicus), Mediterranean house gecko (Hemidactylus turcicus) and flat-tailed house gecko (Hemidactylus platyurus) to reveal homologous regions and to study karyotype evolution in seven gecko species (Gekko gecko, G. japonicus, G. ulikovskii, G. vittatus, Hemidactylus f... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5323186 Tue, 11 Oct 2011 04:00:00 +0100 5323186 http://www.medworm.com/index.php?rid=5323185&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21987186%26dopt%3DAbstract Authors: Seiler DM, Rouquette J, Schmid VJ, Strickfaden H, Ottmann C, Drexler GA, Mazurek B, Greubel C, Hable V, Dollinger G, Cremer T, Friedl AA Abstract Epigenetic alterations induced by ionizing radiation may contribute to radiation carcinogenesis. To detect relative accumulations or losses of constitutive post-translational histone modifications in chromatin regions surrounding DNA double-strand breaks (DSB), we developed a method based on ion microirradiation and correlation of the signal intensities after immunofluorescence detection of the histone modification in question and the DSB marker γ-H2AX. We observed after ionizing irradiation markers for transcriptional silencing, such as accumulation of H3K27me3 and loss of active RNA polymerase II, at chromatin regions labeled ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5323185 Tue, 11 Oct 2011 04:00:00 +0100 5323185 http://www.medworm.com/index.php?rid=5323184&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21987187%26dopt%3DAbstract Authors: Kelly LJ, Leitch IJ Abstract Genome size in plants is characterised by its extraordinary range. Although it appears that the majority of plants have small genomes, in several lineages genome size has reached giant proportions. The recent advent of next-generation sequencing (NGS) methods has for the first time made detailed analysis of even the largest of plant genomes a possibility. In this review, we highlight investigations that have utilised NGS for the study of plants with large genomes, as well as describing ongoing work that aims to harness the power of these technologies to gain insights into their evolution. In addition, we emphasise some areas of research where the use of NGS has the potential to generate significant advances in our current understanding of how p... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5323184 Tue, 11 Oct 2011 04:00:00 +0100 5323184 http://www.medworm.com/index.php?rid=5323187&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21979796%26dopt%3DAbstract Authors: Rovatsos MT, Marchal JA, Romero-Fernández I, Fernández FJ, Giagia-Athanosopoulou EB, Sánchez A Abstract The distribution of telomeric repeats was analyzed by fluorescence in situ hybridization in 15 species of arvicoline rodents, included in three different genera: Chionomys, Arvicola, and Microtus. The results demonstrated that in most or the analyzed species, telomeric sequences are present, in addition to normal telomeres localization, as large blocks in pericentromeric regions. The number, localization, and degree of amplification of telomeric sequences blocks varied with the karyotype and the morphology of the chromosomes. Also, in some cases telomeric amplification at non-pericentromeric regions is described. The interstitial telomeric sequences are evolutionary m... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5323187 Fri, 07 Oct 2011 04:00:00 +0100 5323187 http://www.medworm.com/index.php?rid=5271214&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21953028%26dopt%3DAbstract Authors: Wyngaard GA, Rasch EM, Connelly BA Abstract Embryonic chromatin diminution, the selective excision of large amounts of heterochromatic DNA from presomatic cell lineages, provides an example of an unusually large augmentation of the germline genome and raises questions regarding the source of the increased amount of DNA and its relevance to the biology of the organism. DNA levels in adult germ cell nuclei of the copepod Cyclops kolensis were determined by DNA-Feulgen cytophotometry and compared with those of somatic nuclei of adults and both pre- and postdiminuted embryos from the same mothers. Almost 75 pg DNA/nucleus is excised by diminution, resulting in the return of each generation to the approximately 1 pg DNA/nucleus level found for adult soma. To account for the i... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5271214 Wed, 28 Sep 2011 04:00:00 +0100 5271214 http://www.medworm.com/index.php?rid=5271218&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21947954%26dopt%3DAbstract Authors: Duke Becker SE, Thomas R, Trifonov VA, Wayne RK, Graphodatsky AS, Breen M Abstract The emergence of genome-integrated molecular cytogenetic resources allows for comprehensive comparative analysis of gross karyotype architecture across related species. The identification of evolutionarily conserved chromosome segment (ECCS) boundaries provides deeper insight into the process of chromosome evolution associated with speciation. We evaluated the genome-wide distribution and relative orientation of ECCSs in three wild canid species with diverse karyotypes (red fox, Chinese raccoon dog, and gray fox). Chromosome-specific panels of dog genome-integrated bacterial artificial chromosome (BAC) clones spaced at ∼10-Mb intervals were used in fluorescence in situ hybridization analys... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5271218 Tue, 27 Sep 2011 04:00:00 +0100 5271218 http://www.medworm.com/index.php?rid=5271217&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21947955%26dopt%3DAbstract Authors: Zatloukalová P, Hřibová E, Kubaláková M, Suchánková P, Simková H, Adoración C, Kahl G, Millán T, Doležel J Abstract Cultivated chickpea is the third most important legume after field bean and garden pea worldwide. Despite considerable breeding towards improved yield and resistance to biotic and abiotic stresses, the production of chickpea remained stagnant, but molecular tools are expected to increase the impact of current improvement programs. As a first step towards this goal, various genetic linkage maps have been established and markers linked to resistance genes been identified. However, until now, only one linkage group (LG) has been assigned to a specific chromosome. In the present work, mitotic chromosomes were sorted using flow cytometry and used as tem... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5271217 Tue, 27 Sep 2011 04:00:00 +0100 5271217 http://www.medworm.com/index.php?rid=5271216&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21947956%26dopt%3DAbstract Authors: Ioannou D, Meershoek EJ, Christopikou D, Ellis M, Thornhill AR, Griffin DK Abstract Organisation of chromosome territories in interphase nuclei has been studied in many systems and positional alterations have been associated with disease phenotypes (e.g. laminopathies, cancer) in somatic cells. Altered nuclear organisation is also reported in developmental processes such as mammalian spermatogenesis where a "chromocentre" model is proposed with the centromeres and sex chromosomes repositioning to the nuclear centre. The purpose of this study was to test the hypothesis that alterations in nuclear organisation of human spermatozoa are associated with defects upstream in spermatogenesis (as manifest in certain infertility phenotypes). The nuclear address of (peri-) centromeri... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5271216 Tue, 27 Sep 2011 04:00:00 +0100 5271216 http://www.medworm.com/index.php?rid=5271215&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21947957%26dopt%3DAbstract Authors: Gao Z, Fu S, Dong Q, Han F, Birchler JA Abstract Fluorescence in situ hybridization analysis of a reciprocal translocation in maize between chromosomes 1 and 5 that has been used extensively in maize genetics revealed the presence of an inactive centromere at or near the breakpoints of the two chromosomes. This centromere contains both the satellite repeat, CentC, and the centromeric retrotransposon family, CRM, that are typical of centromere regions in maize. This site does not exhibit any of the tested biochemical features of active centromeres such as association with CENP-C and phosphorylation of serine-10 on histone H3. The most likely scenario for this chromosome arrangement is that a centromere was included in the repair process that formed the translocation but be... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5271215 Tue, 27 Sep 2011 04:00:00 +0100 5271215 http://www.medworm.com/index.php?rid=5182888&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21877225%26dopt%3DAbstract Authors: Hanrahan SJ, Johnston JS Abstract Insect genome size diversity remains poorly sampled, with sparse and sporadic sampling of a few select orders and with many orders unrepresented or underrepresented in the genome size database. Here, we present 134 genome size estimates for 18 orders, including the first ever genome size estimates for eight orders, 38 families, 102 genera, and 131 species. Also reported here are three insect species genome size estimates that are corrections for unpublished genome size values that made it into the literature, including the smallest arthropod genome of the two spot spider mite (1C = 91 Mb). These estimates range from 91 to 7,752 Mb and provide a broader picture of genome size variation within Insecta and among all Arthropods. Proposed... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5182888 Mon, 29 Aug 2011 23:00:00 +0100 5182888 http://www.medworm.com/index.php?rid=5170117&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21870188%26dopt%3DAbstract Authors: Bainard JD, Husband BC, Baldwin SJ, Fazekas AJ, Gregory TR, Newmaster SG, Kron P Abstract Flow cytometry has become the dominant method for estimating nuclear DNA content in plants, either for ploidy determination or quantification of absolute genome size. Current best practices for flow cytometry involve the analysis of fresh tissue, however, this imposes significant limitations on the geographic scope and taxonomic diversity of plants that can be included in large-scale genome size studies. Dried tissue has been used increasingly in recent years, but largely in the context of ploidy analysis. Here we test rapid tissue drying with silica gel as a method for use in genome size studies, potentially enabling broader geographic sampling of plants when fresh tissue collection ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5170117 Thu, 25 Aug 2011 23:00:00 +0100 5170117 http://www.medworm.com/index.php?rid=5146853&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21850457%26dopt%3DAbstract Authors: Janicki M, Rooke R, Yang G Abstract A major portion of most eukaryotic genomes are transposable elements (TEs). During evolution, TEs have introduced profound changes to genome size, structure, and function. As integral parts of genomes, the dynamic presence of TEs will continue to be a major force in reshaping genomes. Early computational analyses of TEs in genome sequences focused on filtering out "junk" sequences to facilitate gene annotation. When the high abundance and diversity of TEs in eukaryotic genomes were recognized, these early efforts transformed into the systematic genome-wide categorization and classification of TEs. The availability of genomic sequence data reversed the classical genetic approaches to discovering new TE families and superfamilies. Curated ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5146853 Wed, 17 Aug 2011 23:00:00 +0100 5146853 http://www.medworm.com/index.php?rid=5146852&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21850458%26dopt%3DAbstract Authors: Agren JA, Wright SI Abstract Most models of genome size evolution emphasize changes in relative rates of and/or the efficacy of selection on insertions and deletions. However, transposable elements (TEs) are a major contributor to genome size evolution, and since they experience their own selective pressures for expansion, genome size changes may in part be driven by the dynamics of co-evolution between TEs and their hosts. Under this perspective, predictions about the conditions that allow for genome expansion may be altered. In this review, we outline the evidence for TE-host co-evolution, discuss the conditions under which these dynamics can change, and explore the possible contribution to the evolution of genome size. Aided partly by advances in our understanding of th... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5146852 Wed, 17 Aug 2011 23:00:00 +0100 5146852 http://www.medworm.com/index.php?rid=5146851&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21850459%26dopt%3DAbstract We present a comparative molecular cytogenetic investigation of ten Rattini species representative of the genera Maxomys, Leopoldamys, Niviventer, Berylmys, Bandicota and Rattus using chromosome banding, cross-species painting (Zoo-fluorescent in situ hybridization or FISH) and BAC-FISH mapping. Our results show that these taxa are characterised by slow to moderate rates of chromosome evolution that contrasts with the extensive chromosome restructuring identified in most other murid rodents, particularly the mouse lineage. This extends to genomic features such as NOR location (for example, NORs on RNO 3 are present on the corresponding chromosomes in all species except Bandicota savilei and Niviventer fulvescens, and the NORs on RNO 10 are conserved in all Rattini with the exception of Rat... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5146851 Wed, 17 Aug 2011 23:00:00 +0100 5146851 http://www.medworm.com/index.php?rid=5146854&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21847691%26dopt%3DAbstract Authors: Bainard JD, Henry TA, Bainard LD, Newmaster SG Abstract Less than 1% of known monilophytes and lycophytes have a genome size estimate, and substantially less is known about the presence and prevalence of endopolyploid nuclei in these groups. Thirty-one monilophyte species (including three horsetails) and six lycophyte species were collected in Ontario, Canada. Using flow cytometry, genome size and degree of endopolyploidy were estimated for 37 species. Across the five orders covered, 1Cx-values averaged 4.2 pg in the Lycopodiales, 18.1 pg for the Equisetales, 5.06 pg for a single representative of the Ophioglossales, 14.3 pg for the Osmundales, and 7.06 pg for the Polypodiales. There was no indication of endoreduplication in any of the leaf, stem, or root tissue analy... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5146854 Tue, 16 Aug 2011 23:00:00 +0100 5146854 http://www.medworm.com/index.php?rid=5036883&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21728140%26dopt%3DAbstract This study reports the discovery and molecular mapping of a resistance gene effective against stem rust races RKQQC and TTKSK (Ug99) derived from Aegilops geniculata (2n = 4x = 28, U(g)U(g)M(g)M(g)). Two populations from the crosses TA5599 (T5DL-5M(g)L·5M(g)S)/TA3809 (ph1b mutant in Chinese Spring background) and TA5599/Lakin were developed and used for genetic mapping to identify markers linked to the resistance gene. Further molecular and cytogenetic characterization resulted in the identification of nine spontaneous recombinants with shortened Ae. geniculata segments. Three of the wheat-Ae. geniculata recombinants (U6154-124, U6154-128, and U6200-113) are interstitial translocations (T5DS·5DL-5M(g)L-5DL), with 20-30% proximal segments of 5M(g)L translocated to 5DL; the other s... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=5036883 Mon, 04 Jul 2011 23:00:00 +0100 5036883 http://www.medworm.com/index.php?rid=4993120&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21691861%26dopt%3DAbstract Authors: Mazzuchelli J, Yang F, Kocher TD, Martins C To better understand the genomic organization and evolution of Sox genes in vertebrates, we cytogenetically mapped Sox2 and Sox14 genes in cichlid fishes and performed comparative analyses of their orthologs in several vertebrate species. The genomic regions neighboring Sox2 and Sox14 have been conserved during vertebrate diversification. Although cichlids seem to have undergone high rates of genomic rearrangements, Sox2 and Sox14 are linked in the same chromosome in the Etroplinae Etroplus maculatus that represents the sister group of all remaining cichlids. However, these genes are located on different chromosomes in several species of the sister group Pseudocrenilabrinae. Similarly, the ancestral synteny of Sox2 and Sox14 has been... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4993120 Mon, 20 Jun 2011 23:00:00 +0100 4993120 http://www.medworm.com/index.php?rid=4939042&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21674259%26dopt%3DAbstract Authors: Schubert V, Meister A, Tsujimoto H, Endo TR, Houben A Supernumerary (B) chromosomes of rye are not required for plant development and exhibit a reduced transcription activity. These special features inspired us to analyse whether there are differences between A and B chromatin organization in interphase nuclei. Applying fluorescence in situ hybridization, we found that both rye A and B chromosomes added to hexaploid wheat showed in meristematic nuclei a string-like shape and a clear Rabl orientation. In 4C differentiated leaf nuclei, a more relaxed chromatin structure, round-shaped chromosome territories and a less pronounced Rabl configuration were found. Also, the observed random association of homologues in 2C and 4C nuclei indicated in general a similar behaviour of A and ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4939042 Tue, 14 Jun 2011 23:00:00 +0100 4939042 http://www.medworm.com/index.php?rid=4939043&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21667174%26dopt%3DAbstract Authors: Monti V, Giusti M, Bizzaro D, Manicardi GC, Mandrioli M The structure of the telomeres of four aphid species (Acyrthosiphon pisum, Megoura viciae, Myzus persicae and Rhopalosiphum padi) was evaluated by Southern blotting and fluorescent in situ hybridization, revealing that each chromosomal end consists of a (TTAGG)( n ) repeat. The presence of a telomerase coding gene has been verified successively in the A. pisum genome, revealing that aphid telomerase shares sequence identity ranging from 12% to 18% with invertebrate and vertebrate homologues, and possesses the two main domains involved in telomerase activity. Interestingly, telomerase expression has been verified in different somatic tissues suggesting that, in aphids, telomerase activity is not as restricted as in human c... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4939043 Fri, 10 Jun 2011 23:00:00 +0100 4939043 http://www.medworm.com/index.php?rid=4939044&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21656257%26dopt%3DAbstract Authors: Kowalski A, Pałyga J Chromatin has a tendency to shift from a relatively decondensed (active) to condensed (inactive) state during cell differentiation due to interactions of specific architectural and/or regulatory proteins with DNA. A promotion of chromatin folding in terminally differentiated avian blood cells requires the presence of either histone H5 in erythrocytes or non-histone protein, myeloid and erythroid nuclear termination stage-specific protein (MENT), in white blood cells (lymphocytes and granulocytes). These highly abundant proteins assist in folding of nucleosome arrays and self-association of chromatin fibers into compacted chromatin structures. Here, we briefly review structural aspects and molecular mode of action by which these unrelated proteins can spre... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4939044 Wed, 08 Jun 2011 23:00:00 +0100 4939044 http://www.medworm.com/index.php?rid=4939066&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21656076%26dopt%3DAbstract Authors: Kuroiwa A, Handa S, Nishiyama C, Chiba E, Yamada F, Abe S, Matsuda Y Tokudaia osimensis (the Amami spiny rat) and Tokudaia tokunoshimensis (the Tokunoshima spiny rat) have a sex chromosome composition of XO/XO, no Y chromosome. The mammalian sex-determining gene, SRY, is also absent in these species, which indicates that these spiny rats exhibit a novel sex-determining mechanism that is independent of SRY. To identify a candidate gene that controls this mechanism, the copy numbers and chromosomal locations of 10 genes with important functions in gonadal differentiation were determined: ATRX, CBX2 (M33), DMRT1, FGF9, NR0B1 (DAX1), NR5A1 (Ad4BP/SF1), RSPO1, SOX9, WNT4, and WT1. Multiple bands were detected for NR0B1 in Southern blot analysis, which suggested the presence of mult... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4939066 Tue, 07 Jun 2011 23:00:00 +0100 4939066 http://www.medworm.com/index.php?rid=4939055&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21656077%26dopt%3DAbstract Authors: Raskina O, Brodsky L, Belyayev A The chromosomal pattern of tandem repeat fractions of repetitive DNA is one of the most important characteristics of a species. In the present research, we aimed to detect and evaluate the level of intraspecific variability in the chromosomal distribution of species-specific Spelt 1 and Aegilops-Triticum-specific Spelt 52 tandem repeats in Aegilops speltoides and in closely related diploid and polyploid species. There is a distinct eco-geographical gradient in Spelt 1 and Spelt 52 blocks abundance in Ae. speltoides. In marginal populations, the number of Spelt 1 chromosomal blocks could be 12-14 times lower than in the center of the species distribution. Also, in related diploid species, the abundance of Spelt 52 correlates with evolutionary pr... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4939055 Tue, 07 Jun 2011 23:00:00 +0100 4939055 http://www.medworm.com/index.php?rid=4893209&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21626175%26dopt%3DAbstract Authors: Nagaki K, Shibata F, Suzuki G, Kanatani A, Ozaki S, Hironaka A, Kashihara K, Murata M Although a centromeric DNA fragment of tobacco (Nicotiana tabacum), Nt2-7, has been reported, the overall structure of the centromeres remains unknown. To characterize the centromeric DNA sequences, we conducted a chromatin immunoprecipitation assay using anti-NtCENH3 antibody and chromatins isolated from two ancestral diploid species (Nicotiana sylvestris and Nicotiana tomentosiformis) of N. tabacum and isolated a 178-pb fragment, Nto1 from N. tomentosiformis, as a novel centromeric DNA. Fluorescence in situ hybridization (FISH) showed that Nto1 localizes on 24 out of 48 chromosomes in some cells of a BY-2 cell line. To identify the origins of the Nt2-7 and Nto1, a tobacco bacterial artifici... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4893209 Fri, 27 May 2011 23:00:00 +0100 4893209 http://www.medworm.com/index.php?rid=4893208&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21626176%26dopt%3DAbstract Authors: PMID: 21626176 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4893208 Fri, 27 May 2011 23:00:00 +0100 4893208 http://www.medworm.com/index.php?rid=4893207&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21626177%26dopt%3DAbstract Authors: PMID: 21626177 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4893207 Fri, 27 May 2011 23:00:00 +0100 4893207 http://www.medworm.com/index.php?rid=4893210&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21618042%26dopt%3DAbstract Authors: PMID: 21618042 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4893210 Thu, 26 May 2011 23:00:00 +0100 4893210 http://www.medworm.com/index.php?rid=4848183&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21573744%26dopt%3DAbstract Authors: Johansen KM, Forer A, Yao C, Girton J, Johansen J PMID: 21573744 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4848183 Sat, 14 May 2011 23:00:00 +0100 4848183 http://www.medworm.com/index.php?rid=4848182&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21573745%26dopt%3DAbstract Authors: Kochneva ML, Tikhonov VN, Bobovich V PMID: 21573745 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4848182 Sat, 14 May 2011 23:00:00 +0100 4848182 http://www.medworm.com/index.php?rid=4848184&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21559983%26dopt%3DAbstract Authors: Beklemisheva VR, Romanenko SA, Biltueva LS, Trifonov VA, Vorobieva NV, Serdukova NA, Rubtsova NV, Brandler OV, O'Brien PC, Yang F, Stanyon R, Ferguson-Smith MA, Graphodatsky AS Glires represent a eutherian clade consisting of rodents and lagomorphs (hares, rabbits, and pikas). Chromosome evolution of Glires is known to have variable rates in different groups: from slowly evolving lagomorphs and squirrels to extremely rapidly evolving muroids. Previous interordinal homology maps between slowly evolving Glires were based on comparison with humans. Here, we used sets of chromosome-specific probes from Tamias sibiricus (Sciuridae), Castor fiber (Castoridae) and humans to study karyotypes of six ground squirrels (genera Marmota and Spermophilus) and one tree squirrel (genus Sciurus... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4848184 Tue, 10 May 2011 23:00:00 +0100 4848184 http://www.medworm.com/index.php?rid=4848185&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21556954%26dopt%3DAbstract Authors: Badaeva ED, Dedkova OS, Zoshchuk SA, Amosova AV, Reader SM, Bernard M, Zelenin AV The genetic classification for the N-genome chromosomes has been developed on the basis of C-banding analysis on the set of Triticum aestivum × Aegilops uniaristata single chromosome addition lines and examination of A. uniaristata ([Formula: see text], NN), Aegilops ventricosa ([Formula: see text], DDNN) and Aegilops recta ([Formula: see text], UUX(n)X(n)NN) accessions carrying intergenomic translocations using fluorescence in situ hybridisation with probes for three repetitive DNA sequences as well as the 5S and 45S rDNA families. The N-genome chromosomes of the tetraploid A. ventricosa show significant changes relative to the diploid progenitor species, while those of the hexaploid A. recta a... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4848185 Mon, 09 May 2011 23:00:00 +0100 4848185 http://www.medworm.com/index.php?rid=4848186&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21547583%26dopt%3DAbstract Authors: Iovene M, Cavagnaro PF, Senalik D, Buell CR, Jiang J, Simon PW The cytogenetic characterization of the carrot genome (Daucus carota L., 2n = 18) has been limited so far, partly because of its somatic chromosome morphology and scant of chromosome markers. Here, we integrate the carrot linkage groups with pachytene chromosomes by fluorescent in situ hybridization (FISH) mapping genetically anchored bacterial artificial chromosomes (BACs). We isolated a satellite repeat from the centromeric regions of the carrot chromosomes, which facilitated the study of the pachytene-based karyotype and demonstrated that heterochromatic domains were mainly confined to the pericentromeric regions of each chromosome. Chromosome-specific BACs were used to: (1) physically locate genetically una... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4848186 Thu, 05 May 2011 23:00:00 +0100 4848186 http://www.medworm.com/index.php?rid=4791312&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21505852%26dopt%3DAbstract Authors: Tian Q, Hanlon Newell AE, Wang Y, Olson SB, Fedorov LM An increasing interest in the molecular mechanisms governing cell division has resulted in the discovery of several groups of genes that participate in the regulation of mitosis and meiosis in eukaryotes. Inactivation of these genes in mice often leads to early embryonic lethality. To show direct causality between mutations of these genes, chromosomal instability and embryonic death, a technique enabling detailed cytogenetic analysis of embryonic cells is required. Here, we develop and test a comprehensive approach that allows complex analysis of individual early postimplantation embryos and combines polymerase chain reaction genotyping with the preparation and detailed karyotypic inspection of cells at the metaphase and a... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4791312 Tue, 19 Apr 2011 23:00:00 +0100 4791312 http://www.medworm.com/index.php?rid=4791313&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21503764%26dopt%3DAbstract Authors: Houben A, Kumke K, Nagaki K, Hause G Microgametogenesis in angiosperms results in two structurally and functionally different cells, one generative cell, which subsequently forms the sperm cells, and the vegetative cell. We analysed the chromatin properties of both types of nuclei after first and second pollen mitosis in rye (Secale cereale). The condensed chromatin of generative nuclei is earmarked by an enhanced level of histone H3K4/K9 dimethylation and H3K9 acetylation. The less condensed vegetative nuclei are RNA polymerase II positive. Trimethylation of H3K27 is not involved in transcriptional downregulation of genes located in generative nuclei as H3K27me3 was exclusively detected in the vegetative nuclei. The global level of DNA methylation does not differ between both... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4791313 Mon, 18 Apr 2011 23:00:00 +0100 4791313 http://www.medworm.com/index.php?rid=4791314&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21499798%26dopt%3DAbstract Authors: Datta S, Alam MP, Majumdar SS, Mehta AK, Maiti S, Wadhwa N, Brahmachari V The expansion of CGG repeats in the 5'-untranslated region (5'UTR) of FMR1 gene is the molecular basis of fragile X syndrome in most of the patients. The nature of the flanking sequences in addition to the length and interruption pattern of repeats is predicted to influence CGG repeat instability in the FMR1 gene. We investigated nucleosome occupancy as a contributor to CGG repeat instability in a transgenic mouse model containing unstable (CGG)(26,) from human FMR1 cloned downstream of nucleosome-excluding sequence. We observe that the transgene has an open chromatin structure compared to the stable endogenous mouse Fmr1 within the same nucleus. CGG repeats in mouse Fmr1 are flanked by nucleosomes unlik... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4791314 Fri, 15 Apr 2011 23:00:00 +0100 4791314 http://www.medworm.com/index.php?rid=4791315&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21484447%26dopt%3DAbstract Authors: Sullivan LL, Boivin CD, Mravinac B, Song IY, Sullivan BA Human centromeres contain multi-megabase-sized arrays of alpha satellite DNA, a family of satellite DNA repeats based on a tandemly arranged 171 bp monomer. The centromere-specific histone protein CENP-A is assembled on alpha satellite DNA within the primary constriction, but does not extend along its entire length. CENP-A domains have been estimated to extend over 2,500 kb of alpha satellite DNA. However, these estimates do not take into account inter-individual variation in alpha satellite array sizes on homologous chromosomes and among different chromosomes. We defined the genomic distance of CENP-A chromatin on human chromosomes X and Y from different individuals. CENP-A chromatin occupied different genomic interva... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4791315 Mon, 11 Apr 2011 23:00:00 +0100 4791315 http://www.medworm.com/index.php?rid=4791316&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21468689%26dopt%3DAbstract Authors: Mendes S, Moraes AP, Mirkov TE, Pedrosa-Harand A The genus Citrus is well-known for its economic importance and complex taxonomy. Only three to six Citrus taxa are considered true biological species, among them is Citrus medica, the citron. Previous studies based on chromomycin A3 (CMA)/4',6-diamidino-2-phenylindole staining showed that the citron has a homomorphic karyotype, consisting of four distinct chromosome types according to the CMA(+) heterochromatin distribution. Based on the pattern of CMA(+) bands and the hybridization of 25 bacterial artificial chromosomes (BACs) from a genomic library of Poncirus trifoliata, a closely related species to the genus Citrus, we were able to identify each chromosome pair and build a comparative cytogenetic map for C. medica. The data ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4791316 Tue, 05 Apr 2011 23:00:00 +0100 4791316 http://www.medworm.com/index.php?rid=4681284&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21461696%26dopt%3DAbstract Authors: Rath U, Sharp DJ The mechanisms that move chromatids poleward during anaphase A have fascinated researchers for decades. There is now growing evidence that this movement is tightly linked to the active depolymerization of both ends of kinetochore-associated microtubules, a mechanism we refer to as "Pacman-Flux." Contemporary data suggest that this is catalyzed by the integration of multiple enzymatic activities including (1) microtubule-end depolymerases housed at the pole or kinetochore, (2) microtubule-severing enzymes used to uncap the ends of kinetochore-associated microtubules, and (3) molecular motors which drive tubulins towards the pole or into kinetochores. PMID: 21461696 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4681284 Fri, 01 Apr 2011 23:00:00 +0100 4681284 http://www.medworm.com/index.php?rid=4681283&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21461697%26dopt%3DAbstract Authors: Moser SC, Swedlow JR Proper mitotic chromosome structure is essential for faithful chromosome segregation. Mounting evidence suggests that mitotic chromosome assembly is a progressive, dynamic process that requires topoisomerase II, condensins and cohesin and the activity of several signalling molecules. Current results suggest how these different activities might interact to achieve the familiar form of the mitotic chromosome. PMID: 21461697 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4681283 Fri, 01 Apr 2011 23:00:00 +0100 4681283 http://www.medworm.com/index.php?rid=4681285&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21445689%26dopt%3DAbstract Authors: Kulemzina AI, Yang F, Trifonov VA, Ryder OA, Ferguson-Smith MA, Graphodatsky AS ABSTACT: Although Tragulidae, as the basal family in Ruminantia phylogenetic tree, is the key taxon for understanding the early chromosome evolution of extant ruminants, comparative molecular cytogenetic data on the tragulids are scarce. Here, we present the first genome-wide comparative map of the Java mouse deer (Tragulus javanicus, Tragulidae) revealed by chromosome painting with human and dromedary probes. Together with the published comparative maps of major representative cetartiodactyl species established with the same set of probes, our results allowed us to reconstruct a 2n = 48 Ruminantia ancestral karyotype, which is similar to the cetartiodactyl ancestral karyotype. The karyotype ev... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4681285 Mon, 28 Mar 2011 23:00:00 +0100 4681285 http://www.medworm.com/index.php?rid=4681286&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21437736%26dopt%3DAbstract Authors: Caputo V, Giovannotti M, Cerioni PN, Splendiani A, Tagliavini J, Olmo E Karyotype and other chromosomal characteristics in the Adriatic brook lamprey Lampetra zanandreai, representative of one of the most ancestral group of vertebrates, were examined using conventional (Ag-staining, C-banding as well as CMA(3) and DAPI fluorescence) and molecular (FISH with 18/28S rDNA and EcoRI satDNA as probes) protocols with metaphase chromosomes derived from whole blood cultures. The chromosome complement had a modal diploid chromosome number of 2n = 164, as in other petromyzontid lamprey species. Ag-staining and CMA(3) fluorescence, as well as FISH with 18/28S rDNA probes, detected nucleolar organizer regions (NORs) close to the centromeres of the biarmed chromosomes of pairs 1 and 2,... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4681286 Fri, 25 Mar 2011 00:00:00 +0100 4681286 http://www.medworm.com/index.php?rid=4626560&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21424324%26dopt%3DAbstract Authors: Zhang H, Dawe RK In eukaryotes, the formation of a bipolar spindle is necessary for the equal segregation of chromosomes to daughter cells. Chromosomes, microtubules and kinetochores all contribute to spindle morphogenesis and have important roles during mitosis. A unique property of flowering plant cells is that they entirely lack centrosomes, which in animals have a major role in spindle formation. The absence of these important structures suggests that plants have evolved novel mechanisms to assure chromosome segregation. In this review, we highlight some of the recent studies on plant mitosis and argue that plants utilize a variation of "spindle self-organization" that takes advantage of the early polarity of plant cells and accentuates the role of kinetochores in stabiliz... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4626560 Sat, 19 Mar 2011 00:00:00 +0100 4626560 http://www.medworm.com/index.php?rid=4626562&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21394511%26dopt%3DAbstract Authors: Volleth M, Yang F, Müller S Up to now, the composition of synteny-conserved segments in chiropteran karyotypes was studied by cross-species chromosome painting with probes derived from whole human (HSA) or chiropteran chromosomes only. Here, painting probes from the vespertilionid bat Myotis myotis were hybridized, for the first time, onto human metaphase chromosomes. The segmental composition of bat karyotypes was further refined by cross-species painting with probes derived from flow-sorted chromosomes of Tupaia belangeri and Eulemur macaco-two species with highly rearranged karyotypes. The use of such probes has led to the generation of higher resolution maps between human chromosomes 1, 3, 4, 5, 6, 11 and 15 and their counterparts in Vespertilionidae and the pteropodid sp... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4626562 Fri, 11 Mar 2011 00:00:00 +0100 4626562 http://www.medworm.com/index.php?rid=4626561&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21394512%26dopt%3DAbstract Authors: Prada CF, Delprat A, Ruiz A The chromosomal relationships of the four martensis cluster species are among the most complex and intricate within the entire Drosophila repleta group, due to the so-called sharing of inversions. Here, we have revised these relationships using comparative mapping of bacterial artificial chromosome (BAC) clones on the salivary gland chromosomes. A physical map of chromosome 2 of Drosophila uniseta (one of the cluster members) was generated by in situ hybridization of 82 BAC clones from the physical map of the Drosophila buzzatii genome (an outgroup that represents the ancestral arrangement). By comparing the marker positions, we determined the number, order, and orientation of conserved chromosomal segments between chromosome 2 of D. buzzatii and D.... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4626561 Fri, 11 Mar 2011 00:00:00 +0100 4626561 http://www.medworm.com/index.php?rid=4507782&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21340745%26dopt%3DAbstract Authors: Koryakov DE, Walther M, Ebert A, Lein S, Zhimulev IF, Reuter G In the present work, we found that the SUUR protein is required for the SU(VAR)3-9 enzyme to bind to the salivary gland polytene chromosomes. The SuUR mutation results in loss of SU(VAR)3-9 on the chromosomes, whereas artificial expression of the SuUR gene restores its binding. The SUUR protein is also involved in methylation of the residues H3K9 and H3K27. However, mono-, di-, and tri-methylated forms of H3K9 and H3K27 behave differently in various chromosomal domains in response to the SuUR mutation. Euchromatin and chromosome 4 are almost completely deprived of mono-, di-, and tri-methylation of H3K9. In the chromocenter, mono-methylation is reduced, di-methylation shows no noticeable changes, and tri-methylatio... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4507782 Tue, 22 Feb 2011 00:00:00 +0100 4507782 http://www.medworm.com/index.php?rid=4507783&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21336668%26dopt%3DAbstract Authors: Rumpler Y, Hauwy M, Fausser JL, Roos C, Zaramody A, Andriaholinirina N, Zinner D The Malagasy primate family Indriidae comprises three genera with up to 19 species. Cytogenetic and molecular phylogenies of the Indriidae have been performed with special attention to the genus Propithecus. Comparative R-banding and FISH with human paints were applied to karyotypes of representatives of all three genera and confirmed most of the earlier R-banding results. However, additional chromosomal rearrangements were detected. A reticulated and a cladistic phylogeny, the latter including hemiplasies, have been performed. Cladistic analysis of cytogenetic data resulted in a phylogenetic tree revealing (1) monophyly of the family Indriidae, (2) monophyly of the genus Avahi, (3) sister-group r... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4507783 Sat, 19 Feb 2011 00:00:00 +0100 4507783 http://www.medworm.com/index.php?rid=4507785&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21331795%26dopt%3DAbstract Authors: Xiao J, Jia X, Wang H, Zhao R, Fang Y, Gao R, Wu Z, Cao A, Wang J, Xue Z, Zhao W, Kang J, Chen Q, Chen P, Wang X Fusarium head blight (FHB), also called wheat scab, is an important disease in warm and humid regions worldwide, which not only reduces crop yield and grain quality, but also is a major safety concern in food and feed production due to mycotoxin contamination. Growing wheat cultivars with FHB resistance is one of the most economical and effective means to control the disease. Chinese wheat landrace Wangshuibai is an important resistant source from southern China. Several resistance QTLs in Wangshuibai were identified and mapped on chromosomes or chromosomal arms including 3BS, 4B, 6BS, 7AL, etc. In the present research, a mutant with increased FHB susceptibility, de... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4507785 Fri, 18 Feb 2011 00:00:00 +0100 4507785 http://www.medworm.com/index.php?rid=4507784&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21331796%26dopt%3DAbstract Authors: Vladimirou E, Harry E, Burroughs N, McAinsh AD As a mechanical system, the kinetochore can be viewed as a set of interacting springs, clutches and motors; the problem of kinetochore mechanism is now one of understanding how these functional modules assemble, disassemble and interact with one another to give rise to the emergent properties of the system. The sheer complexity of the kinetochore system points to a future requirement for data-driven mathematical modelling and statistical analysis based on quantitative empirical measurement of sister kinetochore trajectories. Here, we review existing models of chromosome motion in the context of recent advances in our understanding of kinetochore molecular biology. PMID: 21331796 [PubMed - as supplied by publisher] (Source: Chr... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4507784 Fri, 18 Feb 2011 00:00:00 +0100 4507784 http://www.medworm.com/index.php?rid=4507786&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21311965%26dopt%3DAbstract Authors: Tooley J, Stukenberg PT The Ndc80 complex lies at the heart of the kinetochore, a large protein machine that accurately segregates chromosomes during cell division. The Ndc80 complex has structural roles in assembling the kinetochore, but also functions to congress chromosomes and to signal the spindle checkpoint. It directly binds to microtubules and is currently the best candidate for the long-sought protein that couples microtubule depolymerization to chromosome movement. A combination of structural and genetic data has recently converged to generate the first models for this fascinating motor activity. Additionally, recent data point to an increasingly dynamic role for Ndc80 in the kinetochore-one which involves not only simple binding to microtubules but also shifts in co... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4507786 Fri, 11 Feb 2011 00:00:00 +0100 4507786 http://www.medworm.com/index.php?rid=4450753&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21287260%26dopt%3DAbstract Authors: Alliegro MC The notion of nucleic acids in the spindle, and particularly, the centrosome has a long history of inquiry, doubt, and debate. However, the association of specific RNAs with these structures is now confirmed by several investigators. What their presence means for the assembly, function, and evolution of the cell division apparatus is not known; but with newly available information and probes, these are questions that can finally be addressed. The present article summarizes the history of this field, what we know about the molecules in question, and in light of these findings, emphasizes the need to view the cell division apparatus for what it is by definition, a ribonucleoprotein complex. PMID: 21287260 [PubMed - as supplied by publisher] (Source: Chromosome Re... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4450753 Wed, 02 Feb 2011 00:00:00 +0100 4450753 http://www.medworm.com/index.php?rid=4450755&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21274615%26dopt%3DAbstract Authors: Johansen KM, Forer A, Yao C, Girton J, Johansen J The idea of a spindle matrix has long been proposed in order to account for poorly understood features of mitosis. However, its molecular nature and structural composition have remained elusive. Here, we propose that the spindle matrix may be constituted by mainly nuclear-derived proteins that reorganize during the cell cycle to form an elastic gel-like matrix. We discuss this hypothesis in the context of recent observations from phylogenetically diverse organisms that nuclear envelope and intranuclear proteins form a highly dynamic and malleable structure that contributes to mitotic spindle function. We suggest that the viscoelastic properties of such a matrix may constrain spindle length while at the same time facilitating mi... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4450755 Fri, 28 Jan 2011 00:00:00 +0100 4450755 http://www.medworm.com/index.php?rid=4450754&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21274616%26dopt%3DAbstract Authors: Mirny LA The fractal globule is a compact polymer state that emerges during polymer condensation as a result of topological constraints which prevent one region of the chain from passing across another one. This long-lived intermediate state was introduced in 1988 (Grosberg et al. 1988) and has not been observed in experiments or simulations until recently (Lieberman-Aiden et al. 2009). Recent characterization of human chromatin using a novel chromosome conformational capture technique brought the fractal globule into the spotlight as a structural model of human chromosome on the scale of up to 10 Mb (Lieberman-Aiden et al. 2009). Here, we present the concept of the fractal globule, comparing it to other states of a polymer and focusing on its properties relevant for the biop... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4450754 Fri, 28 Jan 2011 00:00:00 +0100 4450754 http://www.medworm.com/index.php?rid=4450756&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21271286%26dopt%3DAbstract Authors: Buttrick GJ, Millar JB Regulated interaction between kinetochores and the mitotic spindle is essential for the fidelity of chromosome segregation. Potentially deleterious attachments are corrected during prometaphase and metaphase. Correct attachments must persist during anaphase, when spindle-generated forces separate chromosomes to opposite poles. In yeast, the heterodecameric DASH complex plays a vital pole in maintaining this link. In vitro DASH forms both oligomeric patches and rings that can form load-bearing attachments with the tips of polymerising and depolymerising microtubules. In vivo, DASH localises primarily at the kinetochore, and has a role maintaining correct attachment between spindles and chromosomes in both Saccharomyces cerevisiae and Schizosaccharomyces p... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4450756 Thu, 27 Jan 2011 00:00:00 +0100 4450756 http://www.medworm.com/index.php?rid=4386752&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21249442%26dopt%3DAbstract Authors: Berchtold D, Fesser S, Bachmann G, Kaiser A, Eilert JC, Frohns F, Sadoni N, Muck J, Kremmer E, Eick D, Layer PG, Zink D We used chicken retinospheroids (RS) to study the nuclear architecture of vertebrate cells in a three-dimensional (3D) cell culture system. The results showed that the different neuronal cell types of RS displayed an extreme form of radial nuclear organization. Chromatin was arranged into distinct radial zones which became already visible after DAPI staining. The distinct zones were enriched in different chromatin modifications and in different types of chromosomes. Active isoforms of RNA polymerase II were depleted in the outermost zone. Also chromocenters and nucleoli were radially aligned in the nuclear interior. The splicing factor SC35 was enriched at th... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4386752 Thu, 20 Jan 2011 00:00:00 +0100 4386752 http://www.medworm.com/index.php?rid=4386753&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21246271%26dopt%3DAbstract Authors: Peng SF, Cheng YM The B-chromosome of maize contains an A-chromosome centromere-specific satellite CentC repeat in its centromere region (CENB) and at multiple locations in its distal heterochromatic regions (BDHs). Because CentC is highly repetitive, it is a challenge to study CentC sequences within individual centromeres or chromosome regions. The combined structure of CentC and a BDH-specific CL-repeat has allowed us to isolate CentC sequences from BDHs. In the study described herein, we have used a PCR method to amplify 13 CL-CentC variant products that were specifically mapped to A-centromeres (CENAs), the CENB, and BDHs via the tertiary trisomes and hypoploids of five B-10L translocations. Cloning and sequence analyses of these CL-CentC products have revealed a local Cen... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4386753 Wed, 19 Jan 2011 00:00:00 +0100 4386753 http://www.medworm.com/index.php?rid=4386754&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21234670%26dopt%3DAbstract Authors: Qiao H, Lohmiller LD, Anderson LK Proteins of the cohesin complex are essential for sister chromatid cohesion and proper chromosome segregation during both mitosis and meiosis. Cohesin proteins are also components of axial elements/lateral elements (AE/LEs) of synaptonemal complexes (SCs) during meiosis, and cohesins are thought to play an important role in meiotic chromosome morphogenesis and recombination. Here, we have examined the cytological behavior of four cohesin proteins (SMC1, SMC3, SCC3, and REC8/SYN1) during early prophase I in tomato microsporocytes using immunolabeling. All four cohesins are discontinuously distributed along the length of AE/LEs from leptotene through early diplotene. Based on current models for the cohesin complex, the four cohesin proteins shou... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4386754 Fri, 14 Jan 2011 00:00:00 +0100 4386754 http://www.medworm.com/index.php?rid=4386755&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21225334%26dopt%3DAbstract In this study, therefore, we present an algorithm to determine the parent of origin, the phase of origin and the location of chiasmata in a series of nine "trisomy triplets" (i.e. samples derived from father, mother and their trisomic foetus). Novel adaptations of well-established principles are applied along with a simple algorithm written in Microsoft Excel for visualisation of the results. Such analysis has a range of applications in preimplantation and prenatal diagnosis. PMID: 21225334 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4386755 Wed, 12 Jan 2011 00:00:00 +0100 4386755 http://www.medworm.com/index.php?rid=4386756&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21213038%26dopt%3DAbstract Authors: Wakefield J, Rieder C, Macgregor H PMID: 21213038 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4386756 Fri, 07 Jan 2011 00:00:00 +0100 4386756 http://www.medworm.com/index.php?rid=4386757&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21194009%26dopt%3DAbstract Authors: Rieder CL In this review, I stress the importance of direct data and accurate terminology when formulating and communicating conclusions on how the G2/M and metaphase/anaphase transitions are regulated. I argue that entry into mitosis (i.e., the G2/M transition) is guarded by several checkpoint control pathways that lose their ability to delay or stop further cell cycle progression once the cell becomes committed to divide, which in vertebrates occurs in the late stages of chromosome condensation. After this commitment, progress through mitosis is then mediated by a single Mad/Bub-based checkpoint that delays chromatid separation, and exit from mitosis (i.e., completion of the cell cycle) in the presence of unattached kinetochores. When cells cannot satisfy the mitotic checkpo... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4386757 Fri, 31 Dec 2010 00:00:00 +0100 4386757 http://www.medworm.com/index.php?rid=4386761&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21190130%26dopt%3DAbstract Authors: Thompson SL, Compton DA Two prominent features of cancer cells are abnormal numbers of chromosomes (aneuploidy) and large-scale structural rearrangements of chromosomes. These chromosome aberrations are caused by genomic instabilities inherent to most cancers. Aneuploidy arises through chromosomal instability (CIN) by the persistent loss and gain of whole chromosomes. Chromosomal rearrangements occur through chromosome structure instability (CSI) as a consequence of improper repair of DNA damage. The mechanisms that cause CIN and CSI differ, but the phenotypic consequences of aneuploidy and chromosomal rearrangements may overlap considerably. Both CIN and CSI are associated with advanced stage tumors with increased invasiveness and resistance to chemotherapy, indicating that t... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4386761 Wed, 29 Dec 2010 00:00:00 +0100 4386761 http://www.medworm.com/index.php?rid=4386759&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21190132%26dopt%3DAbstract Authors: Weiland Y, Lemmer P, Cremer C The optical resolution of conventional far field fluorescence light microscopy is restricted to about 200 nm laterally and 600 nm axially and has been thought for many decades to be an insurmountable barrier for the quantitative spatial analysis of cellular and hence also nuclear constituents. Novel approaches in light microscopy have now overcome this barrier. Here, we report on a special method of localisation microscopy, spectral precision distance/position determination microscopy and its combination with fluorescence in situ hybridization to analyse the spatial distribution of specific DNA sequences in human cell nuclei at the macromolecular optical resolution level. As an example, repetitive DNA sequence DYZ2 located within the heterochrom... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4386759 Wed, 29 Dec 2010 00:00:00 +0100 4386759 http://www.medworm.com/index.php?rid=4386758&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21190133%26dopt%3DAbstract Authors: Baù D, Marti-Renom MA The three-dimensional (3D) architecture of a genome is non-random and known to facilitate the spatial colocalization of regulatory elements with the genes they regulate. Determining the 3D structure of a genome may therefore probe an essential step in characterizing how genes are regulated. Currently, there are several experimental and theoretical approaches that aim at determining the 3D structure of genomes and genomic domains; however, approaches integrating experiments and computation to identify the most likely 3D folding of a genome at medium to high resolutions have not been widely explored. Here, we review existing methodologies and propose that the integrative modeling platform ( http://www.integrativemodeling.org ), a computational package deve... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4386758 Wed, 29 Dec 2010 00:00:00 +0100 4386758 http://www.medworm.com/index.php?rid=4386762&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21181254%26dopt%3DAbstract Authors: van Royen ME, Zotter A, Ibrahim SM, Geverts B, Houtsmuller AB Fluorescent protein labelling, as well as impressive progress in live cell imaging have revolutionised the view on how essential nuclear functions like gene transcription regulation and DNA repair are organised. Here, we address questions like how DNA-interacting molecules find and bind their target sequences in the vast amount of DNA. In addition, we discuss methods that have been developed for quantitative analysis of data from fluorescence recovery after photobleaching experiments (FRAP). PMID: 21181254 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4386762 Wed, 22 Dec 2010 00:00:00 +0100 4386762 http://www.medworm.com/index.php?rid=4386760&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21190131%26dopt%3DAbstract Authors: McNally JG PMID: 21190131 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4386760 Thu, 09 Dec 2010 00:00:00 +0100 4386760 http://www.medworm.com/index.php?rid=4242066&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21127962%26dopt%3DAbstract This study adds to the evidence that SC-35 domains are hubs of gene activity and gene-domain association may be considered as a common mechanism to enhance gene expression. PMID: 21127962 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4242066 Fri, 03 Dec 2010 00:00:00 +0100 4242066 http://www.medworm.com/index.php?rid=4242067&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21125327%26dopt%3DAbstract Authors: Massip K, Yerle M, Billon Y, Ferchaud S, Bonnet N, Calgaro A, Mary N, Dudez AM, Sentenac C, Plard C, Ducos A, Pinton A Inversions are well-known structural chromosomal rearrangements in humans and pigs. Such rearrangements generally have no effect on the carrier's phenotype. However, the presence of an inversion may impair spermatogenesis and lead to the production of recombinant gametes, responsible for early miscarriages, stillbirth, or congenital abnormalities. This is the first report on meiotic segregation and pairing behavior of the inv(4)(p1.4;q2.3) pericentric inversion in pigs. Despite the very large size of the inverted fragment (76% of the chromosome), SpermFISH results showed that only 4.08% of the gametes produced by male heterozygotes were unbalanced. This low pr... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4242067 Thu, 02 Dec 2010 00:00:00 +0100 4242067 http://www.medworm.com/index.php?rid=4242070&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21116703%26dopt%3DAbstract Authors: Grant J, Verrill C, Coustham V, Arneodo A, Palladino F, Monier K, Khalil A Specific nuclear domains are nonrandomly positioned within the nuclear space, and this preferential positioning has been shown to play an important role in genome activity and stability. Well-known examples include the organization of repetitive DNA in telomere clusters or in the chromocenter of Drosophila and mammalian cells, which may provide a means to control the availability of general repressors, such as the heterochromatin protein 1 (HP1). We have specifically characterized the intranuclear positioning of in vivo fluorescence of the Caenorhabditis elegans HP1 homologue HPL-2 as a marker for heterochromatin domains in developing embryos. For this purpose, the wavelet transform modulus maxima (WTMM... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4242070 Tue, 30 Nov 2010 00:00:00 +0100 4242070 http://www.medworm.com/index.php?rid=4242069&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21116704%26dopt%3DAbstract Authors: Fritsch CC, Langowski J Using Monte Carlo simulations, we have investigated the decondensation of chromosomes during interphase and the diffusive transport of spherical probe particles in the chromatin network. The chromatin fibers are modeled as semiflexible polymer chains on a fixed three-dimensional grid, taking into account their flexibility and eventual chain crossing by the aid of topoisomerases. The network thus created will obstruct the diffusion of macromolecules. A result of our simulations is that crowding of diffusing molecules leaves the dynamics of the chromosomes and the behavior of other diffusing molecules qualitatively unaffected. Furthermore, the capability of the simulated chromatin network to trap diffusing molecules over long times is lower than that meas... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4242069 Tue, 30 Nov 2010 00:00:00 +0100 4242069 http://www.medworm.com/index.php?rid=4242068&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21116705%26dopt%3DAbstract We report here that the α-globin cluster (HBK, HBA) is flanked by C16orf35 and GBY and is located on a pair of microchromosomes, whereas the β-globin cluster is flanked by RRM1 on the 3' end and is located on the long arm of chromosome 3. However, the CCKBR gene that flanks the β-globin cluster on the 5' end in other amniotes is located on the short arm of chromosome 5 in P. vitticeps, indicating that a chromosomal break between the β-globin cluster and CCKBR occurred at least in the agamid lineage. Our data from a reptile species provide further evidence to support the transpositional model for the evolution of β-globin gene cluster in amniotes. PMID: 21116705 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4242068 Tue, 30 Nov 2010 00:00:00 +0100 4242068 http://www.medworm.com/index.php?rid=4196837&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21086038%26dopt%3DAbstract Authors: Heath E, Sablitzky F, Morgan GT RNA-binding motif (RBM) proteins comprise a large family of RNA-binding proteins whose functions are poorly understood. Since some RBM proteins are candidate alternative splicing factors we examined whether one such member of the family, RBM6, exhibited a pattern of nuclear distribution and targeting consistent with this role. Using antibodies raised against mouse RBM6 to immmunostain mammalian cell lines we found that the endogenous protein was both distributed diffusely in the nucleus and concentrated in a small number of nuclear foci that corresponded to splicing speckles/interchromatin granule clusters (IGCs). Tagged RBM6 was also targeted to IGCs, although it accumulated in large bodies confined to the IGC periphery. The basis of this distr... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4196837 Thu, 18 Nov 2010 00:00:00 +0100 4196837 http://www.medworm.com/index.php?rid=4196836&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21086039%26dopt%3DAbstract This article reviews the specialized functions of Rec8 that are crucial for diverse aspects of chromosome dynamics in meiosis, and presents some speculations relating to meiotic chromosome organization. PMID: 21086039 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4196836 Thu, 18 Nov 2010 00:00:00 +0100 4196836 http://www.medworm.com/index.php?rid=4179828&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21080054%26dopt%3DAbstract Authors: Tessadori F, Zeng K, Manders E, Riool M, Jackson D, van Driel R Episomal vectors assembled from defined genetic components are a promising alternative to traditional gene therapy vectors that integrate in the host genome and may cause insertional mutations. The vector pEPI-eGFP is stably retained in the episomal state in cultured mammalian cells at low copy number for many generations without integration into the host genome. Although pEPI-eGFP is a fully engineered vector, little is known about how it interacts with the host genome and about the molecular mechanisms that are responsible for its transcriptional activity. We have analyzed the expression of the episomal reporter gene eGFP under conditions that affect the chromatin state of the genome. We have also constructed pE... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4179828 Tue, 16 Nov 2010 00:00:00 +0100 4179828 http://www.medworm.com/index.php?rid=4134498&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D21046224%26dopt%3DAbstract Authors: Hemmerich P, Schmiedeberg L, Diekmann S The cell nucleus is responsible for the storage, expression, propagation, and maintenance of the genetic material it contains. Highly organized macromolecular complexes are required for these processes to occur faithfully in an extremely crowded nuclear environment. In addition to chromosome territories, the nucleus is characterized by the presence of nuclear substructures, such as the nuclear envelope, the nucleolus, and other nuclear bodies. Other smaller structural entities assemble on chromatin in response to required functions including RNA transcription, DNA replication, and DNA repair. Experiments in living cells over the last decade have revealed that many DNA binding proteins have very short residence times on chromatin. These o... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4134498 Wed, 03 Nov 2010 00:00:00 +0100 4134498 http://www.medworm.com/index.php?rid=4087236&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20953693%26dopt%3DAbstract Authors: Zhao X, Pei Z, Liu J, Qin S, Cai L In this work, a novel method was developed to distinguish nucleosome DNA and linker DNA based on increment of diversity combined with quadratic discriminant analysis (IDQD), using k-mer frequency of nucleotides in genome. When used to predict DNA potential for forming nucleosomes, the model achieved a high accuracy of 94.94%, 77.60%, and 86.81%, respectively, for Saccharomyces cerevisiae, Homo sapiens, and Drosophila melanogaster. The area under the receiver operator characteristics curve of our classifier was 0.982 for S. cerevisiae. Our results indicate that DNA sequence preference is critical for nucleosome formation potential and is likely conserved across eukaryotes. The model successfully identified nucleosome-enriched or nucleosome-dep... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4087236 Fri, 15 Oct 2010 23:00:00 +0100 4087236 http://www.medworm.com/index.php?rid=4087235&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20953694%26dopt%3DAbstract In this study, we used pearl millet pollen to pollinate the pistils of a range of plants in the tribe Triticeae, as well as oat. Seven days after pollination, the dynamics of the pearl millet chromosomes in the embryos were observed using in situ hybridization, probing both the pearl millet genomic DNA and its centromere-specific repeats. In embryos from the crosses with oat, all seven of the pearl millet chromosomes were retained. However, in hybrids with the Triticeae species, chromosome elimination occurred during embryogenesis. Pearl millet chromosome showed chromosome rearrangements and non-disjunction together with micronuclei. These rearranged chromosomes and micronuclei derived from the breakage of bridges and retention of acentric fragments in anaphase, respectively. The cause of ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4087235 Fri, 15 Oct 2010 23:00:00 +0100 4087235 http://www.medworm.com/index.php?rid=4074890&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20949314%26dopt%3DAbstract Authors: Hiruta C, Nishida C, Tochinai S Most daphnid species adopt parthenogenesis and sexual reproduction differentially in response to varied environmental cues, resulting in the production of diploid progenies in both cases. Previous studies have reportedly suggested that daphnids produce their parthenogenetic eggs via apomixis; the nuclear division of mature oocytes should be an equational division similar to somatic mitosis. However, it seems premature to conclude that this has been unequivocally established in any daphnids. Therefore, the objective of our research was to precisely reveal the process and mechanism of parthenogenetic oogenesis and maintenance of diploidy in Daphnia pulex through histology, karyology, and immunohistochemistry. We found that, when a parthenogenetic ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=4074890 Thu, 14 Oct 2010 23:00:00 +0100 4074890 http://www.medworm.com/index.php?rid=3981176&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20848178%26dopt%3DAbstract Authors: Erdel F, Müller-Ott K, Baum M, Wachsmuth M, Rippe K The genome of eukaryotes is organized into a dynamic nucleoprotein complex referred to as chromatin, which can adopt different functional states. Both the DNA and the protein component of chromatin are subject to various post-translational modifications that define the cell's gene expression program. Their readout and establishment occurs in a spatio-temporally coordinated manner that is controlled by numerous chromatin-interacting proteins. Binding to chromatin in living cells can be measured by a spatially resolved analysis of protein mobility using fluorescence microscopy based approaches. Recent advancements in the acquisition of protein mobility data using fluorescence bleaching and correlation methods provide data se... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3981176 Thu, 16 Sep 2010 23:00:00 +0100 3981176 http://www.medworm.com/index.php?rid=3981177&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20842420%26dopt%3DAbstract Authors: Dange T, Joseph A, Grünwald D Cellular life can be described as a dynamic equilibrium of a highly complex network of interacting molecules. For this reason, it is no longer sufficient to "only" know the identity of the participants in a cellular process, but questions such as where, when, and for how long also have to be addressed to understand the mechanism being investigated. Additionally, ensemble measurements may not sufficiently describe individual steps of molecular mobility, spatial-temporal resolution, kinetic parameters, and geographical mapping. It is vital to investigate where individual steps exactly occur to enhance our understanding of the living cell. The nucleus, home too many highly complex multi-order processes, such as replication, transcription, splicing... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3981177 Tue, 14 Sep 2010 23:00:00 +0100 3981177 http://www.medworm.com/index.php?rid=3937334&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20811940%26dopt%3DAbstract In this study, we present data on karyotypes and chromosomal characteristics in 12 species (Aeluroscalabotes felinus, Coleonyx brevis, Coleonyx elegans, Coleonyx variegatus, Eublepharis angramainyu, Eublepharis macularius, Goniurosaurus araneus, Goniurosaurus lichtenfelderi, Goniurosaurus luii, Goniurosaurus splendens, Hemitheconyx caudicinctus, and Holodactylus africanus) covering all genera of the family, and search for the presence of heteromorphic sex chromosomes. Phylogenetic mapping of chromosomal changes showed a long evolutionary stasis of karyotypes with all acrocentric chromosomes followed by numerous chromosomal rearrangements in the ancestors of two lineages. We have found heteromorphic sex chromosomes in only one species, which suggests that sex chromosomes in most GSD species... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3937334 Wed, 01 Sep 2010 23:00:00 +0100 3937334 http://www.medworm.com/index.php?rid=3937333&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20811941%26dopt%3DAbstract Authors: Ruiz-Herrera A, Farré M, Ponsà M, Robinson TJ Monobrachial homology resulting from Robertsonian (Rb) fusions is thought to contribute to chromosomal speciation through underdominance. Given the karyotypic diversity characterizing wild house mouse populations [Mus musculus domesticus, (MMU)], variation that results almost exclusively from Rb fusions (diploid numbers range from 22 to 40) and possibly whole arm reciprocal translocations (WARTs), this organism represents an excellent model for testing hypotheses of chromosomal evolution. Previous studies of chromosome size and recombination rates have failed to explain the bias for certain chromosomes to be involved more frequently than others in these rearrangements. Here, we show that the pericentromeric region of one such... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3937333 Wed, 01 Sep 2010 23:00:00 +0100 3937333 http://www.medworm.com/index.php?rid=3908425&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20734128%26dopt%3DAbstract Authors: O'Meally D, Patel HR, Stiglec R, Sarre SD, Georges A, Marshall Graves JA, Ezaz T Snake sex chromosomes provided Susumo Ohno with the material on which he based his theory of how sex chromosomes differentiate from autosomal pairs. Like birds, snakes have a ZZ male/ZW female sex chromosome system, in which the snake Z is a macrochromosome much the same size as the bird Z. However, the gene content shows clearly that the snake and bird Z chromosomes are completely non-homologous. The molecular aspect of W chromosome degeneration in snakes remains largely unexplored. We used comparative genomic hybridization to identify the female-specific region of the W chromosome in representative species of Australian snakes. Using this approach, we show that an increasingly complex suite of r... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3908425 Mon, 23 Aug 2010 23:00:00 +0100 3908425 http://www.medworm.com/index.php?rid=3881043&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20717716%26dopt%3DAbstract Authors: Badaeva ED, Zoshchuk SA, Paux E, Gay G, Zoshchuk NV, Roger D, Zelenin AV, Bernard M, Feuillet C Chromosomal distribution of the Fat element that was isolated from bacterial artificial chromosome (BAC) end sequences of wheat chromosome 3B was studied in 45 species representing eight genera of Poaceae (Aegilops, Triticum, Agropyron, Elymus, Secale, Hordeum, Avena and Triticale) using fluorescence in situ hybridisation (FISH). The Fat sequence was not present in oats and in two barley species, Hordeum vulgare and Hordeum spontaneum, that we investigated. Only very low amounts of the Fat element were detected on the chromosomes of two other barley species, Hordeum geniculatum and Hordeum chilense, with different genome compositions. The chromosomes of other cereal species exhibite... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3881043 Tue, 17 Aug 2010 23:00:00 +0100 3881043 http://www.medworm.com/index.php?rid=3881044&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20714801%26dopt%3DAbstract Authors: Finan K, Cook PR, Marenduzzo D Four specific forces (H-bonds, van der Waals forces, hydrophobic and charge interactions) shape the structure of proteins, and many biologists assume they will determine the shape of all structures in the cell. However, as the mass and contour length of a human chromosome are ~7 orders of magnitude larger than those of a typical protein, additional forces can become significant. We review evidence that additional non-specific (entropic) forces are major determinants of chromosomal shape and position. They are sufficient to drive the segregation (de-mixing) of newly replicated DNA to the poles of bacterial cells, while an entropic centrifuge can both form human chromosomes into territories and position them appropriately in nuclei; more locally, a... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3881044 Mon, 16 Aug 2010 23:00:00 +0100 3881044 http://www.medworm.com/index.php?rid=3862558&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20697834%26dopt%3DAbstract We examined A- and B-chromosome pairing and recombination in 12 males from the farm-bred population of the silver fox (2n = 34 + 0-10 Bs) by means of electron and immunofluorescent microscopy. To detect recombination at A and B chromosomes, we used immunolocalisation of MLH1, a mismatch repair protein of mature recombination nodules, at synaptonemal complexes. The mean total number of MLH1 foci at A-autosomes was 29.6 foci per cell. The XY bivalent had one MLH1 focus at the pairing region. Total recombination length of the male fox genome map was estimated as 1,530 centimorgans. We detected single MLH1 foci at 61% of linear synaptic configurations involving B chromosomes. The distribution of the foci along B- and A-bivalents was the same. This may be considered as a first molecular evidenc... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3862558 Mon, 09 Aug 2010 23:00:00 +0100 3862558 http://www.medworm.com/index.php?rid=3862557&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20697835%26dopt%3DAbstract Authors: PMID: 20697835 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3862557 Mon, 09 Aug 2010 23:00:00 +0100 3862557 http://www.medworm.com/index.php?rid=3808246&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20661639%26dopt%3DAbstract Authors: Kerr E, Kiyuna T, Boyle S, Saito A, Thomas JS, Bickmore WA The use of immunofluorescence (IF) and fluorescence in situ hybridisation (FISH) underpins much of our understanding of how chromatin is organised in the nucleus. However, there has only recently been an appreciation that these types of study need to move away from cells grown in culture and towards an investigation of nuclear organisation in cells in situ in their normal tissue architecture. Such analyses, however, especially of archival clinical samples, often requires use of formalin-fixed paraffin wax-embedded tissue sections which need addition steps of processing prior to IF or FISH. Here we quantify the changes in nuclear and chromatin structure that may be caused by these additional processing steps. Treatments... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3808246 Mon, 26 Jul 2010 23:00:00 +0100 3808246 http://www.medworm.com/index.php?rid=3773310&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20635197%26dopt%3DAbstract Authors: Noronha RC, Nagamachi CY, O'Brien PC, Ferguson-Smith MA, Pieczarka JC We analyzed the meiotic behavior of the sex chromosomes of the bats Glossophaga soricina (XX/XY), Artibeus cinereus and Uroderma magnirostrum (neo-XX/XY) using multicolor FISH. The X chromosome and pair 15 autosome probes are from Phyllostomus hastatus and the Y from Carollia brevicauda. On both species with the neo-XX/XY system, the autosome translocated to the sex chromosomes is the pair 15 in P. hastatus, a synapomorphy. The analysis of meiosis confirms that the X and Y have a pseudo-autosomal region, with a typical end-to-end pairing. The autosomal regions of the neo-XX/XY shows different levels of condensation when compared to the original XX/XY. The compound system presented a characteristic shape, as ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3773310 Thu, 15 Jul 2010 23:00:00 +0100 3773310 http://www.medworm.com/index.php?rid=3741209&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20607598%26dopt%3DAbstract Authors: Madalena CR, Fernandes T, Villasante A, Gorab E In Drosophila, telomere retrotransposons counterbalance the loss of telomeric DNA. The exceptional mechanism of telomere recovery characterized in Drosophila has not been found in lower dipterans (Nematocera). However, a retroelement resembling a telomere transposon and termed "RaTART" has been described in the nematoceran Rhynchosciara americana. In this work, DNA and protein sequence analyses, DNA cloning, and chromosomal localization of probes obtained either by PCR or by screening a genomic library were carried out in order to examine additional features of this retroelement. The analyses performed raise the possibility that RaTART represents a genomic clone composed of distinct repetitive elements, one of which is likely to ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3741209 Tue, 06 Jul 2010 23:00:00 +0100 3741209 http://www.medworm.com/index.php?rid=3724085&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20596765%26dopt%3DAbstract This study represents the first time a member of the family Myzopodidae has been investigated using chromosome painting. Painting probes of M. myotis were used to delimit 29, 24, 23, and 22 homologous chromosomal segments in the genomes of M. aurita, M. jugularis, M. griveaudi, and M. goudoti, respectively. Comparison of GTG-banded homologous chromosomes/chromosomal segments among the four species revealed the genome of M. aurita has been structured through 14 fusions of chromosomes and chromosomal segments of M. myotis chromosomes leading to a karyotype consisting solely of bi-armed chromosomes. In addition, chromosome painting revealed a novel X-autosome translocation in M. aurita. Comparison of our results with published chromosome maps provided further evidence for karyotypic conservat... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3724085 Thu, 01 Jul 2010 23:00:00 +0100 3724085 http://www.medworm.com/index.php?rid=3718797&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20582567%26dopt%3DAbstract Authors: Veyrunes F, Catalan J, Tatard C, Cellier-Holzem E, Watson J, Chevret P, Robinson TJ, Britton-Davidian J The African pygmy mouse, Mus minutoides, displays extensive Robertsonian (Rb) diversity. The two extremes of the karyotypic range are found in South Africa, with populations carrying 2n = 34 and 2n = 18. In order to reconstruct the scenario of chromosomal evolution of M. minutoides and test the performance of Rb fusions in resolving fine-scale phylogenetic relationships, we first describe new karyotypes, and then perform phylogenetic analyses by two independent methods, using respectively mitochondrial cytochrome b sequences and chromosomal rearrangements as markers. The molecular and chromosomal phylogenies were in perfect congruence, providing strong confidence both for th... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3718797 Fri, 25 Jun 2010 23:00:00 +0100 3718797 http://www.medworm.com/index.php?rid=3700067&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20574822%26dopt%3DAbstract Authors: Murata C, Yamada F, Kawauchi N, Matsuda Y, Kuroiwa A The Okinawa spiny rat, Tokudaia muenninki, is the only species with a Y chromosome in the genus Tokudaia. Its phylogenic relationship with two XO/XO species, Tokudaia osimensis and Tokudaia tokunoshimensis, lacking a Y chromosome and the mammalian sex-determining gene SRY, is unknown. Furthermore, there has been little cytogenetic analysis of the sex chromosomes in T. muenninki. Therefore, we constructed molecular phylogenetic trees with nucleotide sequences of cyt b, RAG1, and IRBP. All trees strongly supported that T. muenninki was the first to diverge from the Tokudaia ancestor, indicating that loss of the Y chromosome and SRY occurred in the common ancestor of the two XO/XO species after T. muenninki diverged. We found t... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3700067 Wed, 23 Jun 2010 23:00:00 +0100 3700067 http://www.medworm.com/index.php?rid=3700066&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20574823%26dopt%3DAbstract Authors: Mota-Velasco JC, Ferreira IA, Cioffi MB, Ocalewicz K, Campos-Ramos R, Shirak A, Lee BY, Martins C, Penman DJ Oreochromis karongae, one of the "chambo" tilapia species from Lake Malawi, has a karyotype of 2n = 38, making it one of the few species investigated to differ from the typical tilapia karyotype (2n = 44). The O. karongae karyotype consists of one large subtelocentric pair of chromosomes, four medium-sized pairs (three subtelocentric and one submetacentric) and 14 small pairs. The five largest pairs could be distinguished from each other on the basis of size, morphology and a series of fluorescence in situ hybridisation (FISH) probes. The largest pair is easily distinguished on the basis of size and a chromosome 1 (linkage group 3) bacterial artificial chromosome (BAC) ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3700066 Wed, 23 Jun 2010 23:00:00 +0100 3700066 http://www.medworm.com/index.php?rid=3700068&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20571876%26dopt%3DAbstract Authors: Mason AS, Huteau V, Eber F, Coriton O, Yan G, Nelson MN, Cowling WA, Chèvre AM Gene introgression into allopolyploid crop species from diploid or polyploid ancestors can be accomplished through homologous or homoeologous chromosome pairing during meiosis. We produced trigenomic Brassica interspecific hybrids (genome complements AABC, BBAC and CCAB) from the amphidiploid species Brassica napus (AACC), Brassica juncea (AABB) and Brassica carinata (BBCC) in order to test whether the structure of each genome affects frequencies of homologous and homoeologous (both allosyndetic and autosyndetic) pairing during meiosis. AABC hybrids produced from three genotypes of B. napus were included to assess the genetic control of homoeologous pairing. Multi-colour fluorescent in situ hybri... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3700068 Tue, 22 Jun 2010 23:00:00 +0100 3700068 http://www.medworm.com/index.php?rid=3688099&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20568005%26dopt%3DAbstract Authors: Ewers E, Yoda K, Hamid AB, Weise A, Manvelyan M, Liehr T Twenty-five dicentric small supernumerary marker chromosomes (sSMC) derived from #13/21, #14, #15, #18, and #22 were studied by immunohistochemistry for their centromeric activity. Centromere protein (CENP)-B was applied as marker for all centromeres and CENP-C to label the active ones. Three different 'predominant' activation patterns could be observed, i.e., centric fusion or either only one or all two centromeres were active. In one inherited case, the same activation pattern was found in mother and son. In acrocentric-derived sSMC, all three activation patterns could be present. In contrary, in chromosome 18-derived sSMC, only the fusion type was observed. In concordance with previous studies a certain centromeric pl... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3688099 Mon, 21 Jun 2010 23:00:00 +0100 3688099 http://www.medworm.com/index.php?rid=3688098&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20568006%26dopt%3DAbstract Authors: Martin C, Chen S, Jackson DA Cell type and tissue architecture correlate with genome organization in higher eukaryotes, and structural nuclear landmarks are faithfully transmitted from one cell generation to the next. However, how nuclear components find their place in the nucleus after mitosis is still a matter of debate. As the major structural proteins within nuclei, the nuclear lamins are good candidates to re-establish nuclear compartments following mitosis. Human cells with reduced expression of the major B-type lamin protein, lamin B1, were generated using RNA interference. Mitotic and nuclear assembly phenotypes were then visualized in both fixed and living cells. Mitotic defects in lamin B1-depleted cells correlated with a general deterioration in nuclear compartmenta... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3688098 Mon, 21 Jun 2010 23:00:00 +0100 3688098 http://www.medworm.com/index.php?rid=3672174&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20544269%26dopt%3DAbstract Authors: Cheng YM Evolution of heterochromatic regions in the B long arm was studied in two directions: construction of a phylogenetic tree from mutational variants of CL-repeat and analysis of the XbaI fragments carrying CL-repeat and the repeat structural variants. Using tertiary trisomes and hypoploids of a set of B-10L translocations, the fragments associated with CL-repeat and the variants in each of the three distal heterochromatic (DH) regions were identified. Twenty fragments comprising the CL-repeat were observed in the B-chromosome, and each was assigned to an individual DH region. Four deletions, one insertion, and a large number of mutational variants from each of the three DH regions were isolated and sequenced. The sequences of 27 mutational variants were used to establis... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3672174 Thu, 10 Jun 2010 23:00:00 +0100 3672174 http://www.medworm.com/index.php?rid=3652844&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20535633%26dopt%3DAbstract Authors: Davis JK, Thomas PJ, , Thomas JW A hallmark feature of the male-specific region of the human Y chromosome is the presence of large and near-identical palindromes. These palindromes are maintained in a state of near identity via gene conversion between the arms of the palindrome, and both neutral and selection-based theories have been proposed to explain their enrichment on the human Y and X chromosomes. While those proposed theories would be applicable to sex chromosomes in other species, it has not been established whether near-identical palindromes are a common feature of sex chromosomes in a broader range of taxa, including other tetrapods. Here, we report the genomic sequencing and features of a 279-kb region of the non-recombining portion of the W chromosome spanning the ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3652844 Wed, 09 Jun 2010 23:00:00 +0100 3652844 http://www.medworm.com/index.php?rid=3652845&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20532610%26dopt%3DAbstract Authors: Meggendorfer M, Weierich C, Wolff H, Brack-Werner R, Cremer T A new experimental approach was designed to test different predictions of current models of the nuclear architecture with respect to the topography of transcription. We constructed a plasmid, termed pIndi, which carries a reporter gene coding for a red cytoplasmic fluorescent reporter protein. Transcription of the reporter gene is regulated by the inducible promoter of the human immunodeficiency virus (HIV) and is strongly dependent on the HIV-1 Tat protein. Expressing the red fluorescent reporter protein allowed us to distinguish between cells with active and silent reporter genes. Importantly, transient transfection resulted in the clustering of plasmids, forming one or several extra-chromosomal pIndi bodies. Repe... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3652845 Mon, 07 Jun 2010 23:00:00 +0100 3652845 http://www.medworm.com/index.php?rid=3632830&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20521165%26dopt%3DAbstract Authors: Hauffe HC, Giménez MD, Garagna S, Searle JB Laboratory house mice (Mus musculus) with the XXY condition can be generated with ease and have been used as a biomedical model. However, although the XXY constitution has been described in humans and many domestic and wild mammal species, and a very large number of wild house mice have been karyotyped previously, no wild individuals of M. musculus with an XXY karyotype have ever been reported. Therefore, it is rather extraordinary that two wild XXY house mice were caught by us on two different farms in northern Italy in 2008. Except for the extra X chromosome, one male had a standard karyotype (2n = 40) and the other, the karyotype of the Cremona metacentric population (2n = 22). In this paper, the phenotype of these two individu... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3632830 Wed, 02 Jun 2010 23:00:00 +0100 3632830 http://www.medworm.com/index.php?rid=3589278&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20490650%26dopt%3DAbstract Authors: Barros E Silva AE, Marques A, Dos Santos KG, Guerra M Most species of Citrus and related genera display a similar karyotype with 2n = 18 and a variable number of terminal heterochromatic blocks positively stained with chromomycin A(3) (CMA(+) bands). Some of these blocks are 45S rDNA sites, whereas others may correspond to the main GC-rich satellite DNA found in several Citrus species. In the present work, the distribution of the 45S rDNA and the main satellite DNA isolated from C. sinensis (CsSat) were investigated by in situ hybridization in seven species of Citrus, two species of closely related genera (Fortunella obovata and Poncirus trifoliata) and four species of the subfamily Aurantioideae, which were less related to Citrus (Atalantia monophylla, Murraya paniculata, Sev... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3589278 Thu, 20 May 2010 23:00:00 +0100 3589278 http://www.medworm.com/index.php?rid=3578081&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20480223%26dopt%3DAbstract Authors: Pathak D, Srivastava J, Samad R, Parwez I, Kumar S, Ali S Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5' CCTCCAGCCCTCCTCCAGCCCT 3'), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3578081 Mon, 17 May 2010 23:00:00 +0100 3578081 http://www.medworm.com/index.php?rid=3544511&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20449646%26dopt%3DAbstract Authors: Fonsêca A, Ferreira J, Dos Santos TR, Mosiolek M, Bellucci E, Kami J, Gepts P, Geffroy V, Schweizer D, Dos Santos KG, Pedrosa-Harand A A cytogenetic map of common bean was built by in situ hybridization of 35 bacterial artificial chromosomes (BACs) selected with markers mapping to eight linkage groups, plus two plasmids for 5S and 45S ribosomal DNA and one bacteriophage. Together with three previously mapped chromosomes (chromosomes 3, 4, and 7), 43 anchoring points between the genetic map and the cytogenetic map of the species are now available. Furthermore, a subset of four BAC clones was proposed to identify the 11 chromosome pairs of the standard cultivar BAT93. Three of these BACs labelled more than a single chromosome pair, indicating the presence of repetitive DNA in... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3544511 Thu, 06 May 2010 23:00:00 +0100 3544511 http://www.medworm.com/index.php?rid=3512208&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20422279%26dopt%3DAbstract Authors: Gaeta ML, Yuyama PM, Sartori D, Fungaro MH, Vanzela AL Copaifera langsdorffii possesses 2n = 24 large meta- and submetacentric chromosomes (5.97-2.60 mum) in comparison with other Caesalpinioideae trees. Chromosome banding revealed an abundance of GC-rich blocks with a few differences in the size and location of bands between different populations. Polymerase chain reaction and digestion with restriction enzyme RsaI were carried out in order to isolate repetitive DNAs, yielding three fragments of different size: (1) cp-rDNA-like, 109 bp (pCl03 clone); (2) Ty1-copia-like retroelement, 185 bp (pCl23 clone); and (3) Ty3-gypsy-like retroelement, 269 bp (pCl08 clone). The first clone produced unmistakable hybridization signals at subterminal and intercalary positions, coinciding wi... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3512208 Mon, 26 Apr 2010 23:00:00 +0100 3512208 http://www.medworm.com/index.php?rid=3472387&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20390340%26dopt%3DAbstract Authors: Krylov V, Kubickova S, Rubes J, Macha J, Tlapakova T, Seifertova E, Sebkova N Laser microdissection was used for the preparation of whole chromosome painting probes in Silurana (Xenopus) tropicalis. Subsequent cross-species fluorescence in situ hybridization (Zoo-FISH) on its tetraploid relative Xenopus laevis revealed persistence of chromosomal quartets even after 50-65 million years of separate evolution. Their arrangement is in a partial concordance with previous experiments based on similarity of a high-resolution replication banding pattern. Further support for an allotetraploid origin of X. laevis was given by hybridization with a probe derived from the smallest X. tropicalis chromosome (Xt10). Here, pericentric areas of both arms of Xl 14 and 18 were stained, indicating... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3472387 Tue, 13 Apr 2010 23:00:00 +0100 3472387 http://www.medworm.com/index.php?rid=3454941&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20379801%26dopt%3DAbstract In this study, we used whole chromosome painting probes of the field vole Microtus agrestis to detect regions of homology in the karyotypes of eight Microtus species. For almost all investigated species, species-specific associations of conserved chromosomal segments were revealed. Analysis of data obtained here and previously published data allowed us to propose that the ancestral Microtus species had a 2n = 54 karyotype, including two associations of field vole chromosomal segments (MAG 1/17 and 2/8). Further mapping of the chromosome rearrangements onto a molecular phylogenetic tree allows the reconstruction of a karyotype evolution pathway in the Microtus genus. PMID: 20379801 [PubMed - as supplied by publisher] (Source: Chromosome Research) Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3454941 Thu, 08 Apr 2010 23:00:00 +0100 3454941 http://www.medworm.com/index.php?rid=3445394&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20373140%26dopt%3DAbstract Authors: Premi S, Srivastava J, Epplen JT, Ali S Owing to clonal inheritance, haploid status and lack of recombination, structural polymorphism in the human Y chromosome is more prevalent than that in the remaining parts of the genome. We studied structural organization of the AZFc region, assessed microdeletions therein and studied copy number variation (CNV) of several candidate genes in 750 Indian males. FISH mapping of 13 Y-specific BAC/cosmid clones uncovered a hitherto unreported AZFc configuration showing inter-DAZ gene sequence onto the Yp instead of Yq region. Such inter-DAZ gene arrangements were also detected in five German males (European Y). In 40-50% males, partial u3 and one of the green amplicons, g1, g2 or g3 was present on the Yp in addition to Yq, suggesting an alter... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3445394 Tue, 06 Apr 2010 23:00:00 +0100 3445394 http://www.medworm.com/index.php?rid=3436474&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20361248%26dopt%3DAbstract Authors: Gauthier P, Hima K, Dobigny G Pericentromeric repeats have been claimed to mediate centric fusions through heterologous recombination of arrays of tandemly repeated and highly homogenized motifs. However, mammalian case studies are essentially restricted to pathologic fusions in human, or to the house mouse Roberstonian (Rb) races. We here provide an example in a wild gerbil rodent, Gerbillus nigeriae, which displays an extensive Rb polymorphism, with 2n ranging between 2n = 60 and 74. The distribution of two closely related repeats, GERB1 and GERB2 that were previously isolated by Volobouev et al. (Chromosoma 104:252-259, 1995) in this African species, were investigated in the genomes of seven individuals with various diploid numbers. Our results clearly show that GERB1 and G... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3436474 Thu, 01 Apr 2010 23:00:00 +0100 3436474 http://www.medworm.com/index.php?rid=3433347&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20358399%26dopt%3DAbstract Authors: Bi K, Bogart JP The meiotic mechanism of unisexual salamanders in the genus Ambystoma was previously explained by observing lampbrush chromosomes (LBCs). In polyploid unisexual females, a pre-meiotic endomitotic event doubles the chromosome number so that, after meiotic reduction, the mature eggs have the same ploidy as the female. It was assumed that synapses during meiotic I prophase, which result in observed bivalents, join duplicated sister chromosomes. Previous studies also found LBC quadrivalents in some oocytes that could be explained by occasional synapses between homologs. The discovery of widespread intergenomic exchanges among unisexual populations has prompted new speculations on this meiotic mechanism. Synapses that involve homeologous chromosomes may be frequent ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3433347 Wed, 31 Mar 2010 23:00:00 +0100 3433347 http://www.medworm.com/index.php?rid=3425596&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20352325%26dopt%3DAbstract In this study, we characterized four novel eliminated DNA families, EEPs1-4, from the Taiwanese hagfish Paramyxine sheni. Sequences of these four elements occupied 20-27% of eliminated DNA in total, and each family was arranged mainly in tandem in the germline genome with high copy numbers. Although most of these elements were eliminated, a minor fraction remained in somatic cells. Some eliminated DNA families are shared as eliminated sequences between Eptatretidae and Myxinidae. Fluorescence in situ hybridization (FISH) of these elements showed that not only heterochromatic chromosomes but also both ends of euchromatic chromosomes in germ cells are absent in somatic cells of P. sheni. It strongly suggests that chromosome terminus elimination, in addition to whole chromosome elimination, c... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3425596 Mon, 29 Mar 2010 23:00:00 +0100 3425596 http://www.medworm.com/index.php?rid=3397002&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20306126%26dopt%3DAbstract Authors: Meyer JM, Kurtti TJ, Van Zee JP, Hill CA In spite of the global medical and veterinary importance of Ixodid ticks, relatively little is known about their genome organization. To address this, we developed the first fluorescence in situ hybridization (FISH)-based chromosome markers in the Lyme disease vector, Ixodes scapularis. Shotgun genomic DNA (gDNA) sequences were used to identify three major tandem repeat families which were localized to specific heterochromatic regions of I. scapularis chromosomes prepared from the mitotic cell line ISE18. Together, these repeats were estimated to contribute approximately 159 Mb (8%) of the 2.1 Gb (haploid) I. scapularis genome. The relative arrangement of each tandem repeat family and the nucleolar organizing regions was determined by r... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3397002 Sat, 20 Mar 2010 00:00:00 +0100 3397002 http://www.medworm.com/index.php?rid=3351298&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20213139%26dopt%3DAbstract Authors: Hofmann A, Brünner M, Schwendemann A, Strödicke M, Karberg S, Klebes A, Saumweber H, Korge G The PEV-modifying winged-helix/forkhead domain transcription factor JUMU of Drosophila is an essential protein of pleiotropic function. The correct gene dose of jumu is required for nucleolar integrity and correct nucleolus function. Overexpression of jumu results in bloating of euchromatic chromosome arms, displacement of the JUMU protein from the chromocenter and the nucleolus, fragile weak points, and disrupted chromocenter of polytene chromosomes. Overexpression of the acidic C terminus of JUMU alone causes nucleolus disorganization. In addition, euchromatic genes are overexpressed and HP1, which normally accumulates in the pericentric heterochromatin and spreads into euc... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3351298 Sat, 06 Mar 2010 00:00:00 +0100 3351298 http://www.medworm.com/index.php?rid=3339847&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20204495%26dopt%3DAbstract Authors: Tek AL, Kashihara K, Murata M, Nagaki K The centromere as a kinetochore assembly site is fundamental to the partitioning of genetic material during cell division. In order to determine the functional centromeres of soybean, we characterized the soybean centromere-specific histone H3 (GmCENH3) protein and developed an antibody against the N-terminal end. Using this antibody, we cloned centromere-associated DNA sequences by chromatin immunoprecipitation. Our analyses indicate that soybean centromeres are composed of two distinct satellite repeats (GmCent-1 and GmCent-4) and retrotransposon-related sequences (GmCR). The possible allopolyploid origin of the soybean genome is discussed in view of the centromeric satellite sequences present. PMID: 20204495 [PubMed - as supplied ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3339847 Fri, 05 Mar 2010 00:00:00 +0100 3339847 http://www.medworm.com/index.php?rid=3339846&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20204496%26dopt%3DAbstract Authors: Ropiquet A, Hassanin A, Pagacova E, Gerbault-Seureau M, Cernohorska H, Kubickova S, Bonillo C, Rubes J, Robinson TJ The four-horned antelope, Tetracerus quadricornis, is a karyotypic novelty in Bovidae since chromosomal evolution in this species is driven by tandem fusions in contradiction to the overwhelming influence of Robertsonian fusions in other species within the family. Using a combination of differential staining and molecular cytogenetic techniques, we provide the first description of the species' karyotype, draw phylogenetic inferences from the cytogenetic data and discuss possible mechanisms underlying the formation of the tandem fusions in this species. We show (a) that pairs 1-6 of Tetracerus correspond to a combination of Bos taurus orthologous chromosomes that ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3339846 Fri, 05 Mar 2010 00:00:00 +0100 3339846 http://www.medworm.com/index.php?rid=3335776&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20198417%26dopt%3DAbstract Authors: de Oliveira EH, Tagliarini MM, Rissino JD, Pieczarka JC, Nagamachi CY, O'Brien PC, Ferguson-Smith MA Evolutionary cytogenetics can take confidence from methodological and analytical advances that promise to speed up data acquisition and analysis. Drastic chromosomal reshuffling has been documented in birds of prey by FISH. However, the available probes, derived from chicken, have the limitation of not being capable of determining if breakpoints are similar in different species: possible synapomorphies are based on the number of segments hybridized by each of chicken chromosome probes. Hence, we employed FACS to construct chromosome paint sets of the white hawk (Leucopternis albicollis), a Neotropical species of Accipitridae with 2n = 66. FISH experiments enabled us to assign s... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3335776 Wed, 03 Mar 2010 00:00:00 +0100 3335776 http://www.medworm.com/index.php?rid=3335775&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20198418%26dopt%3DAbstract Authors: Koo DH, Nam YW, Choi D, Bang JW, de Jong H, Hur Y Chromosomes often serve as one of the most important molecular aspects of studying the evolution of species. Indeed, most of the crucial mutations that led to differentiation of species during the evolution have occurred at the chromosomal level. Furthermore, the analysis of pachytene chromosomes appears to be an invaluable tool for the study of evolution due to its effectiveness in chromosome identification and precise physical gene mapping. By applying fluorescence in situ hybridization of 45S rDNA and CsCent1 probes to cucumber pachytene chromosomes, here, we demonstrate that cucumber chromosomes 1 and 2 may have evolved from fusions of ancestral karyotype with chromosome number n = 12. This conclusion is further supported b... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3335775 Wed, 03 Mar 2010 00:00:00 +0100 3335775 http://www.medworm.com/index.php?rid=3335774&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20198419%26dopt%3DAbstract Authors: Santos J, Serra L, Solé E, Pascual M Microsatellites are highly polymorphic markers that are distributed through all the genome being more abundant in non-coding regions. Whether they are neutral or under selection, these markers if localized can be used as co-dominant molecular markers to explore the dynamics of the evolutionary processes. Their cytological localization can allow identifying genes under selection, inferring recombination from a genomic point of view, or screening for the genomic reorganizations occurring during the evolution of a lineage, among others. In this paper, we report for the first time the localization of microsatellite loci by fluorescent in situ hybridization on Drosophila polytene chromosomes. In Drosophila subobscura, 72 dinucleotide micros... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3335774 Wed, 03 Mar 2010 00:00:00 +0100 3335774 http://www.medworm.com/index.php?rid=3299370&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20177772%26dopt%3DAbstract We report on the characterization of the Peromyscus melanophrys karyotype and sex chromosome system. Classic studies reported the sex chromosome system of this species may be as complex as an X(1)X(1)X(2)X(2)/X(1)X(2)Y(1)Y(2) and provided conflicting identification of the X chromosome. Using Peromyscus maniculatus chromosome paints, we have positively identified the sex chromosomes and clarified the sex determining system that once perplexed Peromyscus researchers. The sex chromosomes are characterized by a unique autosomal translocation of DNA shared between both the X and Y chromosomes. The translocated material is late replicating and heterochromatic yet retains the active chromatin conformation. Thus, autosomal regions derived from translocations involving repeat-rich material may reta... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3299370 Tue, 23 Feb 2010 00:00:00 +0100 3299370 http://www.medworm.com/index.php?rid=3299369&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20177773%26dopt%3DAbstract Authors: Suzuki K, Ohbayashi F, Nikaido I, Okuda A, Takaki H, Okazaki Y, Mitani K Chromosomal integration of exogenous DNA in mammalian cells allows stable gene expression for a variety of biological applications. Although it is presumably mediated by DNA repair machinery, little is known regarding site preferences and other characteristics. We isolated and analyzed 256 chromosomal-plasmid DNA integration junctions from 158 plasmid integrants after electroporation in mouse embryonic stem (ES) cells. The frequency of integrations in transcription units (40%) showed a slight but significant increase over the frequency estimated by computer simulation of random events (30%), suggesting preferential integration into genes. Microarray analysis revealed preference into genes, which are expre... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3299369 Tue, 23 Feb 2010 00:00:00 +0100 3299369 http://www.medworm.com/index.php?rid=3276396&cid=s_38023_50_f&fid=38023&url=http%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fentrez%2Fquery.fcgi%3Ftmpl%3DNoSidebarfile%26db%3DPubMed%26cmd%3DRetrieve%26list_uids%3D20155315%26dopt%3DAbstract Authors: Shaw A, Olivares-Chauvet P, Maya-Mendoza A, Jackson DA The control of DNA replication is of fundamental importance as cell proliferation demands that identical copies of the genetic material are passed to the two daughter cells that form during mitosis. These genetic copies are generated in the preceding S phase, where the entire DNA complement of the mother cell must be copied exactly once. As part of this process, it is known that different regions of mammalian genomes are replicated at specific times of a temporally defined replication programme. The key feature of this programme is that active genes in euchromatin are replicated before inactive ones in heterochromatin. This separation of S phase into periods where different classes of chromatin are duplicated is important ... Chromosome Research journals http://www.medworm.com/rss/comments.php?id=3276396 Sat, 13 Feb 2010 00:00:00 +0100 3276396