ListeriaThis is an RSS file. You can use it to subscribe to this data in your favourite RSS reader, such as GoogleReader, or to display this data on your own website or blog. Subscribe to this data using MyMedWorm.Subscribe to this data using GoogleReader.Subscribe to this data using Bloglines.Subscribe to this data using MyYahoo.

This page shows you your search results in order of date.

Pages: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27

1328 records returned

Smoked salmon recalled for ListeriaEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
NEW YORK, Nov. 20 (UPI) -- Some lots of "Brooklyn's Best Brand" smoked salmon are being recalled because of a potentially deadly bacteria found in some packages, U.S. authorities said. (Source: Health News - UPI.com)
Source: Health News - UPI.com - November 20, 2009 Category: Consumer Health News Source Type: news

Service Smoked Fish Corp. Recalls Smoked Nova Salmon Because of Possible Health RiskEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Service Smoked Fish Corp. of Brooklyn, NY, is recalling specific “Use-By” dates and lot codes of Brooklyn’s BEST brand SMOKED NOVA SALMON because they have the potential to be contaminated with Listeria monocytogenes, an organism which can cause serious and sometimes fatal infections in young children, frail or elderly people, and others with weakened immune systems. Although healthy individuals may possibly suffer only short-term symptoms such as high fever, severe headache, stiffness, nausea, abdominal pain and diarrhea, Listeria infection can cause miscarriages and stillbirths among pregnant women. (Source: Food a...
Source: Food and Drug Administration - November 20, 2009 Category: Food Science Source Type: organizations

The path to Crohn's disease: Is mucosal pathology a secondary event?Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Current models of Crohn's disease (CD) invoke an initial disturbance of the epithelial interface between the gut mucosa and intestinal microbiota. This "outside-in" paradigm, mirroring the pathophysiology of acute gastroenteritis, suggests that mucosal damage by luminal bacteria is an early, initiating factor in the etiopathogenesis of disease. However, a number of features of CD argue against a primary mucosal process, including phenotypic studies of CD patients that point to a macrophage defect and genetic studies that predict impaired innate immunity to intracellular bacteria. Intracellular pathogens, such as Listeria, ...
Source: Inflammatory Bowel Diseases - November 19, 2009 Category: Gastroenterology Authors: Marcel A. Behr Source Type: journals

Quality Attributes and Microbial Storage Stability of Caviar from Cultivated White Sturgeon (Acipenser transmontanus)Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Caviar was prepared from white sturgeon (Acipenser transmontanus) roe by adjusting the water phase salt (WPS) to 4.0% to 6.3% by adding food grade NaCl. Fish were obtained from 2 different farms from the Inland Northwest (N = 5). Salt was absorbed at a different rate and to a different extent by roe from different fish. The lipid content in the fish roe varied from 10.2% to 14.4% (w/w), with palmitic acid and oleic acid being the most abundant saturated and monounsaturated fatty acids present, respectively. The caviar contained high levels of polyunsaturated fatty acids (PUFA) (35% to 37%) with docosahexanoic acid being th...
Source: Journal of Food Science - November 19, 2009 Category: Food Science Authors: Joong-Han Shin, Alexandra C.M. Oliveira, Barbara A. Rasco Source Type: journals

Quantification of Listeria monocytogenes in minimally processed leafy vegetables using a combined method based on enrichment and 16S rRNA real-time PCR.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of ...
Source: Food Microbiology - November 18, 2009 Category: Food Science Authors: Aparecida de Oliveira M, Abeid Ribeiro EG, Morato Bergamini AM, Pereira De Martinis EC Tags: Food Microbiol Source Type: journals

Inactivation of Escherichia coli O157:H7, Listeria monocytogenes, Salmonella enterica and Shigella flexneri on spinach leaves by X-ray.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Several recent foodborne disease outbreaks associated with leafy green vegetables, including spinach, have been reported. X-ray is a non-thermal technology that has shown promise for reducing pathogenic and spoilage bacteria on spinach leaves. Inactivation of inoculated Escherichia coli O157:H7, Listeria monocytogenes, Salmonella enterica and Shigella flexneri on spinach leaves using X-ray at different doses (0.1, 0.2, 0.3, 0.5, 0.75, 1.0, 1.5 and 2.0 kGy) was studied. The effect of X-ray on color quality and microflora counts (mesophilic counts, psychrotrophic counts and yeast and mold counts) of untreated and treated...
Source: Food Microbiology - November 18, 2009 Category: Food Science Authors: Mahmoud BS, Bachman G, Linton RH Tags: Food Microbiol Source Type: journals

Evaluation of an enterocin AS-48 enriched bioactive powder obtained by spray drying.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Enterocin AS-48 is a cationic cyclic bacteriocin produced by Enterococcus faecalis with broad bactericidal activity. Currently we are assaying the efficacy of AS-48 as biopreservative in foods. In this work we have applied the spray drying process to different AS-48 liquid samples to obtain active dried preparations. We have also assayed different methods, heat, UV irradiation and filtration, to inactivate/remove the AS-48 producer cells from the samples. Best results were obtained for the sample from CM-25 cation exchange, for which it was also possible to completely eliminate/inactivate the producer cells by heat or ...
Source: Food Microbiology - November 18, 2009 Category: Food Science Authors: Ananou S, Muñoz A, Martínez-Bueno M, González-Tello P, Gálvez A, Maqueda M, Valdivia E Tags: Food Microbiol Source Type: journals

Sodium lactate, sodium diacetate and pediocin: Effects and interactions on the thermal inactivation of Listeria monocytogenes on bologna.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
The effects and interactions of temperature (56.3-60 degrees C), sodium lactate (SL; 0-4.8%), sodium diacetate (SD; 0-0.25%) and pediocin (0-10,000 AU) on Listeria monocytogenes on bologna were studied and a predictive inactivation model was developed. Bologna was manufactured with different SL/SD concentrations in the formulation, dipped in pediocin solution and treated at different temperatures using combinations of parameters determined by central composite design. D-values were calculated and analyzed using second order response regression. Predicted D-values were also calculated. The observed D-values for L. monoc...
Source: Food Microbiology - November 18, 2009 Category: Food Science Authors: Maks N, Zhu L, Juneja VK, Ravishankar S Tags: Food Microbiol Source Type: journals

Factors affecting growth of foodborne pathogens on minimally processed apples.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Escherichia coli O157:H7, Salmonella and Listeria innocua increased by more than 2 log(10) units over a 24 h period on fresh-cut 'Golden Delicious' apple plugs stored at 25 and 20 degrees C. L. innocua reached the same final population level at 10 degrees C meanwhile E. coli and Salmonella only increased 1.3 log(10) units after 6 days. Only L. innocua was able to grow at 5 degrees C. No significant differences were observed between the growth of foodborne pathogens on fresh-cut 'Golden Delicious', 'Granny Smith' and 'Shampion' apples stored at 25 and 5 degrees C. The treatment of 'Golden Delicious' and 'Granny Smith' a...
Source: Food Microbiology - November 18, 2009 Category: Food Science Authors: Alegre I, Abadias M, Anguera M, Oliveira M, Viñas I Tags: Food Microbiol Source Type: journals

Amplified Fragment Length Polymorphism and Multi-Locus Sequence Typing for high-resolution genotyping of Listeria monocytogenes from foods and the environment.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
In conclusion the two methods can be perfectly integrated for high-resolution genotyping of L. monocytogenes. PMID: 19913699 [PubMed - in process] (Source: Food Microbiology)
Source: Food Microbiology - November 18, 2009 Category: Food Science Authors: Parisi A, Latorre L, Normanno G, Miccolupo A, Fraccalvieri R, Lorusso V, Santagada G Tags: Food Microbiol Source Type: journals

Effects of X-ray radiation on Escherichia coli O157:H7, Listeria monocytogenes, Salmonella enterica and Shigella flexneri inoculated on shredded iceberg lettuce.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
The main goal of this investigation was to study the efficacy of X-ray doses (0.1, 0.2, 0.3, 0.5, 0.75, 1.0, 1.5 and 2.0 kGy) on inoculated Escherichia coli O157: H7, Listeria monocytogenes, Salmonella enterica and Shigella flexneri on shredded iceberg lettuce. The second goal was to study the effect of X-ray on the inherent microflora counts and visual color of shredded iceberg lettuce during storage at 4 degrees C for 30 days. Treatment with 1.0 kGy X-ray significantly reduced the population of E. coli O157: H7, L. monocytogenes, Salmonella enterica and S. flexneri on shredded iceberg lettuce by 4.4, 4.1, 4.8 and 4.4...
Source: Food Microbiology - November 18, 2009 Category: Food Science Authors: Mahmoud BS Tags: Food Microbiol Source Type: journals

Fate of Listeria monocytogenes during freezing, thawing and home storage of frankfurters.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
This study examined the effects of antimicrobials, refrigerated storage, freezing, thawing method, and post-thawing storage (7 degrees C) on L. monocytogenes on frankfurters. Inoculated (2.1 log CFU/cm(2)) frankfurters formulated without (control) or with antimicrobials (1.5% potassium lactate plus 0.1% sodium diacetate) were vacuum-packaged, stored at 4 degrees C for 6 or 30 d and then frozen (-15 degrees C) for 10, 30, or 50 d. Packages were thawed under refrigeration (7 degrees C, 24 h), on a countertop (23 +/- 2 degrees C, 8 h), or in a microwave oven (2450 MHz, 1100 watts, 220 s followed by 120 s holding), and then st...
Source: Food Microbiology - November 18, 2009 Category: Food Science Authors: Simpson Beauchamp C, Byelashov OA, Geornaras I, Kendall PA, Scanga JA, Belk KE, Smith GC, Sofos JN Tags: Food Microbiol Source Type: journals

Effect of nanovesicle-encapsulated nisin on growth of Listeria monocytogenes in milk.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Commercial nisin was encapsulated in nanovesicles (mean diameter 140 nm) prepared from partially purified soy lecithin. Nisin-loaded liposomes and unencapsulated (free) nisin were initially tested in BHI medium and skim milk inoculated with Listeria monocytogenes and incubated for 48 h at 30 degrees C. At such abuse temperature conditions, free nisin showed better inhibitory than the liposomal counterparts. Subsequently, the effect of encapsulated or free nisin was evaluated in combination with refrigeration (7 +/- 1 degrees C) in both whole (3.25% fat) and skim (0% fat) milk for up to 14 day. A decrease of 3-4 log cyc...
Source: Food Microbiology - November 18, 2009 Category: Food Science Authors: da Silva Malheiros P, Daroit DJ, da Silveira NP, Brandelli A Tags: Food Microbiol Source Type: journals

Re-evaluation, Optimization, and Multilaboratory Validation of the PulseNet-Standardized Pulsed-Field Gel Electrophoresis Protocol for Listeria monocytogenesEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Foodborne Pathogens and Disease , Vol. 0, No. 0. (Source: Foodborne Pathogens and Disease)
Source: Foodborne Pathogens and Disease - November 13, 2009 Category: Food Science Tags: article Source Type: journals

Multilocus Sequence Typing of Outbreak-Associated Listeria monocytogenes Isolates to Identify Epidemic ClonesEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Foodborne Pathogens and Disease , Vol. 0, No. 0. (Source: Foodborne Pathogens and Disease)
Source: Foodborne Pathogens and Disease - November 13, 2009 Category: Food Science Tags: article Source Type: journals

Synthesis of N-Alkyl-β-d-glucosylamines and Their Antimicrobial Activity against Fusarium proliferatum, Salmonella typhimurium, and Listeria innocuaEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Journal of Agricultural and Food Chemistry, Volume 0, Issue 0, Articles ASAP (As Soon As Publishable). (Source: Journal of Agricultural and Food Chemistry)
Source: Journal of Agricultural and Food Chemistry - November 13, 2009 Category: Food Science Tags: article Source Type: journals

Listeria causes illness at much lower doseEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
ATHENS, Ga., Nov. 13 (UPI) -- Pregnant women may get ill from Listeria at lower doses than previously thought, U.S. researchers found. (Source: Health News - UPI.com)
Source: Health News - UPI.com - November 13, 2009 Category: Consumer Health News Source Type: news

A trans-Acting Riboswitch Controls Expression of the Virulence Regulator PrfA in Listeria monocytogenesEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Edmund Loh, Olivier Dussurget, Jonas Gripenland, Karolis Vaitkevicius, Teresa Tiensuu, Pierre Mandin, Francis Repoila, Carmen Buchrieser, Pascale Cossart, Jörgen Johansson. Riboswitches are RNA elements acting in cis, controlling expression of their downstream genes through a metabolite-induced alteration of their secondary structure. Here, we demonstrate that.... (Source: Cell)
Source: Cell - November 13, 2009 Category: Cytology Source Type: journals

Pregnancy Does not Deter the Development of a Potent Maternal Protective CD8+ T-Cell Acquired Immune Response Against Listeria Monocytogenes Despite Preferential Placental ColonizationEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Conclusion Maternal hosts generate a normal Listeria-specific adaptive immunity in particular CD8+ T-cell memory response suggesting that systemic listeriosis during pregnancy may be an immunopathology associated with placental infection. (Source: American Journal of Reproductive Immunology)
Source: American Journal of Reproductive Immunology - November 13, 2009 Category: Allergy & Immunology Authors: Lakshmi Krishnan, Branka Pejcic-Karapetrovic, Komal Gurnani, Ahmed Zafer, Subash Sad Source Type: journals

Listeria rocourtiae sp. nov.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
A Listeria-like strain isolated in Austria from pre-cut lettuce fitted with the description of the genus Listeria although it could not be assigned to any of the known species. Comparison of the rrs gene (coding 16S rRNA) sequence and gene content by DNA-array indicates affiliation to the genus Listeria. Phylogenetic distance with known Listeria species indicates it represents a new species. Since it can be differentiated from all other known species of Listeria by using phenotypic tests, the name Listeria rocourtiae is proposed for the new species. The type strain is CIP 109804(T) (= DSM 22097(T), Allerberger 700284/0...
Source: International Journal of Systematic and Evolutionary Microbiology - November 13, 2009 Category: Microbiology Authors: Leclercq A, Clermont D, Bizet C, Grimont PA, Le Flèche-Matéos A, Roche SM, Buchrieser C, Cadet-Daniel V, Le Monnier A, Lecuit M, Allerberger F Tags: Int J Syst Evol Microbiol Source Type: journals

Infectious Encephalitis in France in 2007: A National Prospective StudyEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Conclusions. Our prospective study provides an overview of the clinical and etiologic patterns of acute infectious encephalitis in adults in France. Herpes simplex virus 1 remains the main cause of encephalitis, but bacteria accounts for the highest case‐fatality rates. (Source: Clinical Infectious Diseases Latest Issue)
Source: Clinical Infectious Diseases Latest Issue - November 12, 2009 Category: Infectious Diseases Tags: article MAJOR ARTICLE Source Type: journals

Survival of Listeria monocytogenes in Simulated Gastrointestinal System and Transcriptional Profiling of Stress- and Adhesion-Related GenesEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Foodborne Pathogens and Disease , Vol. 0, No. 0. (Source: Foodborne Pathogens and Disease)
Source: Foodborne Pathogens and Disease - November 9, 2009 Category: Food Science Tags: article Source Type: journals

Maple Leaf plant's problems persisted after listeria findEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
A Maple Leaf Foods plant that was scrubbed from top to bottom after a deadly listeriosis outbreak continued to have problems in the months that followed, newly released documents show. (Source: CBC | Health)
Source: CBC | Health - November 9, 2009 Category: Consumer Health News Source Type: news

A Listeria monocytogenes Strain Is Still Virulent despite Nonfunctional Major Virulence GenesEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
This study aimed to characterize the A23 strain, which exhibits a pulsed‐field gel electrophoresis profile specific to low‐virulence strains. This strain has the same causal mutations as the group III strains and a supplementary mutation in the mpl gene, leading to the absence of internalin A expression and the presence of inactive internalin B, phosphatidyl‐inositol phospholipase C, and phosphatidylcholine phospholipase C. Despite these mutations in major virulence genes, the A23 strain formed plaques in cell monolayers and contaminated 100% of inoculated mice, suggesting that it evolved from group III strains by ac...
Source: The Journal of Infectious Diseases Latest Issue - November 6, 2009 Category: Infectious Diseases Tags: article BRIEF REPORT Source Type: journals

Oleanolic acid and ursolic acid affect peptidoglycan metabolism in Listeria monocytogenes.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
The plant pentacyclic triterpenoids, oleanolic and ursolic acids, inhibit the growth and survival of many bacteria, particularly Gram-positive species, including pathogenic ones. The effect of these compounds on the facultative human pathogen Listeria monocytogenes was examined. Both acids affected cell morphology and enhanced autolysis of the bacterial cells. Autolysis of isolated cell walls was inhibited by oleanolic acid, but the inhibitory activity of ursolic acid was less pronounced. Both compounds inhibited peptidoglycan turnover and quantitatively affected the profile of muropeptides obtained after digestion of ...
Source: Antonie van Leeuwenhoek - November 6, 2009 Category: Microbiology Authors: Kurek A, Grudniak AM, Szwed M, Klicka A, Samluk L, Wolska KI, Janiszowska W, Popowska M Tags: Antonie Van Leeuwenhoek Source Type: journals

Galleria mellonella as model system to study Listeria pathogenesis.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Essential aspects of the innate immune response to microbial infection are conserved between insects and mammals. This has generated interest in using insects as model organisms to study host-microbe interactions. We used the greater wax moth Galleria mellonella, which can be reared at 37 degrees C, as a model host for examining virulence potential of Listeria spp.. Here we report that Galleria is an excellent surrogate model of listerial septic infection, capable of clearly distinguishing between pathogenic and non-pathogenic Listeria and even between virulent and attenuated Listeria monocytogenes strains. Virulence r...
Source: Applied and Environmental Microbiology - November 6, 2009 Category: Microbiology Authors: Mukherjee K, Altincicek B, Hain T, Domann E, Vilcinskas A, Chakraborty T Tags: Appl Environ Microbiol Source Type: journals

Sub-lethal concentrations of common disinfectants influence virulence gene expression in Listeria monocytogenes.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Listeria monocytogenes is a food-borne human pathogen that causes listeriosis, a relative rare infection with a high fatality rate. The regulation of virulence gene expression is influenced by several environmental factors, and the aim of the present study was to determine how disinfectants, used routinely in the food industry, affect the expression of different virulence genes in L. monocytogenes when added in sub-lethal concentrations. An agar-based assay was developed to screen the effect of disinfectants on virulence gene promoter expression and was validated at the transcriptional level by Northern blot analysis. ...
Source: Applied and Environmental Microbiology - November 6, 2009 Category: Microbiology Authors: Kastbjerg VG, Larsen MH, Gram L, Ingmer H Tags: Appl Environ Microbiol Source Type: journals

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition ...
Source: Microbiology - November 5, 2009 Category: Microbiology Authors: van der Veen S, van Schalkwijk S, Molenaar D, de Vos WM, Abee T, Wells-Bennik MH Tags: Microbiology Source Type: journals

Listeria monocytogenes does not survive ingestion by Acanthamoeba polyphaga.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
This study used short-term co-culture at 15, 22 and 37 degrees C to examine the interaction L. monocytogenes strains with Acanthamoeba polyphaga (ACO12). Survival of L. monocytogenes cells phagocytosed by monolayers of trophozoites was assessed by culture techniques and microscopy. A. polyphaga trophozoites eliminated bacterial cells within few hours post phagocytosis irrespective of the incubation temperature used. Wild-type L. monocytogenes and phenotypic listeriolysin O mutants were unable to either multiply or survive within trophozoites. By contrast, Salmonella enterica serovar Typhimurium C5 cells used as controls we...
Source: Microbiology - November 5, 2009 Category: Microbiology Authors: Akya A, Pointon A, Thomas C Tags: Microbiology Source Type: journals

Gammadelta T Lymphocytes Producing Ifngamma and Il-17 In Response To Candida Albicans Or Mycobacterial Antigens: Possible Implications For Acute And Chronic Inflammation.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
T lymphocytes bearing the gammadelta T cell receptor are known to play an important role in the first-line defense against viral, bacterial and fungal pathogens. Two main subsets of gammadelta T cells are known, showing distinct functional behaviour: Vdelta2 T lymphocytes, circulating in the peripheral blood, are involved in the response to mycobacterial infections and certain viruses, including coxsakie virus B3 and herpes simplex virus type 2. Vdelta1 T cells are resident in the mucosal-associated lymphoid tissue and are reported to participate in the immunity against Listeria monocytogenes and cytomegalovirus. Vdelt...
Source: Current Medicinal Chemistry - November 5, 2009 Category: Chemistry Authors: Poggi A, Catellani S, Musso A, Zocchi MR Tags: Curr Med Chem Source Type: journals

Inhibition of Fungi and Gram-Negative Bacteria by Bacteriocin BacTN635 Produced by Lactobacillus plantarum sp. TN635.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
The aim of this study was to evaluate 54 lactic acid bacteria (LAB) strains isolated from meat, fermented vegetables and dairy products for their capacity to produce antimicrobial activities against several bacteria and fungi. The strain designed TN635 has been selected for advanced studies. The supernatant culture of this strain inhibits the growth of all tested pathogenic including the four Gram-negative bacteria (Salmonella enterica ATCC43972, Pseudomonas aeruginosa ATCC 49189, Hafnia sp. and Serratia sp.) and the pathogenic fungus Candida tropicalis R2 CIP203. Based on the nucleotide sequence of the 16S rRNA gene o...
Source: Applied Biochemistry and Biotechnology - November 4, 2009 Category: Biochemistry Authors: Smaoui S, Elleuch L, Bejar W, Karray-Rebai I, Ayadi I, Jaouadi B, Mathieu F, Chouayekh H, Bejar S, Mellouli L Tags: Appl Biochem Biotechnol Source Type: journals

Cutting Edge: Memory CD8 T Cell Compartment Grows in Size with Immunological Experience but Nevertheless Can Lose Function.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
The size of the adaptive immune system is considered to be kept constant by the attrition of pre-existing memory. However, recently it was shown that the CD8 memory compartment can grow in size and the number of pre-existing memory is largely preserved, predicting that pre-existing immunity should be maintained (Vezys et al.; Nature 457: 196-199). Experimental proof for this assumption is still lacking. We address this question in the Listeria monocytogenes (L.m.) infection model and confirm the growth of size of the memory compartment by subsequent vaccination with modified vaccinia virus Ankara. We also find only mod...
Source: Journal of Immunology - November 4, 2009 Category: Allergy & Immunology Authors: Huster KM, Stemberger C, Gasteiger G, Kastenmüller W, Drexler I, Busch DH Tags: J Immunol Source Type: journals

Nisin-induced expression of pediocin in dairy lactic acid bacteriaEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Conclusions: The LAB hosts were able to produce enough pediocin to inhibit the growth of L. monocytogenes Scott A; the growth of L. monocytogenes NR30 was effectively inhibited only by the Lact. casei transformants.Significance and Impact of the Study: This is the first time that the NICE system has been used to express the intact pediocin operon in these LAB hosts. This system could allow for the in situ production of pediocin in fermented dairy foods supplemented with nisin to prevent listeria contamination. (Source: Journal of Applied Microbiology)
Source: Journal of Applied Microbiology - November 4, 2009 Category: Microbiology Authors: J.A. Renye Jr., G.A. Somkuti Source Type: journals

Dps proteins prevent Fenton mediated oxidative damage by trapping hydroxyl radicals within the protein shell.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Dps proteins (DNA binding proteins from starved cells) belong to a widespread bacterial family expressed under nutritional and oxidative stress conditions. In particular, Dps proteins protect DNA against Fenton mediated oxidative stress as they catalyze iron oxidation by hydrogen peroxide at highly conserved ferroxidase centers and thus reduce significantly hydroxyl radicals production. The present work investigates the possible generation of intraprotein radicals during the ferroxidation reaction by Escherichia coli and Listeria innocua Dps, two representative members of the family. Stopped flow analyses show that the...
Source: Free Radical Biology and Medicine - November 2, 2009 Category: Biology Authors: Bellapadrona G, Ardini M, Ceci P, Stefanini S, Chiancone E Tags: Free Radic Biol Med Source Type: journals

Bacterial Contamination of Hands Increases Risk of Cross-contamination among Low-income Puerto Rican Meal PreparersEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Conclusions and Implications: Meal preparer's hands can be a vehicle of pathogen transmission during meal preparation. (Source: Journal of Nutrition Education and Behavior)
Source: Journal of Nutrition Education and Behavior - October 31, 2009 Category: Nutrition Authors: Jigna Morarji Dharod, Stefania Paciello, Angela Bermúdez-Millán, Kumar Venkitanarayanan, Grace Damio, Rafael Pérez-Escamilla Tags: Research Articles Source Type: journals

Microbiological analysis of composts produced on South Carolina poultry farmsEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Aims: The purpose of this study was to determine whether the methods used in compost operations of small and medium-sized poultry forms resulted in the production of an amendment free of foodborne pathogens.Methods and Results: Nine compost heaps on five South Carolina poultry farms were surveyed at different stages of the composting process. Compost samples were analysed for coliforms and enriched for Escherichia coli O157:H7, Salmonella spp. and Listeria monocytogenes. The waste materials and composting practices differed among the surveyed farms. On two farms, new materials were added to heaps that had previously comple...
Source: Journal of Applied Microbiology - October 30, 2009 Category: Microbiology Authors: M.W. Shepherd Jr, P. Liang, X. Jiang, M.P. Doyle, M.C. Erickson Source Type: journals

Advaxis Receives IRB Approval For Cervical Dysplasia Trial Of ADXS11-001Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Advaxis, Inc., (OTCBB: ADXS), the live, attenuated Listeria monocytogenes (Lm) biotechnology company, has received approval from the New England Institutional Review Board (IRB) to enroll the first patient in a Phase II clinical trial of cervical dysplasia (cervical intraepithelial neoplasia or CIN). (Source: Health News from Medical News Today)
Source: Health News from Medical News Today - October 29, 2009 Category: Consumer Health News Tags: Clinical Trials / Drug Trials Source Type: news

Polymorphism of actA gene is not related to in vitro virulence of Listeria monocytogenes.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
In conclusion, data presented in this study have revealed considerable differences in the ability of L. monocytogenes strains to invade host cells and suggest the presence of additional factors that may contribute to adhesion and invasion. Virulence of L. monocytogenes is still not fully understood in some respects. Further studies focused on the mechanisms of L. monocytogenes pathogenicity together with the development of more reliable and efficient methods for virulence determination in this species are still required. PMID: 19913932 [PubMed - as supplied by publisher] (Source: International Journal of Food Microbiology)
Source: International Journal of Food Microbiology - October 29, 2009 Category: Food Science Authors: Conter M, Vergara A, Di Ciccio P, Zanardi E, Ghidini S, Ianieri A Tags: Int J Food Microbiol Source Type: journals

Listeria monocytogenes ActA is a key player in evading autophagic recognition.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Autophagy is a pivotal bulk degradation system that eliminates undesirable molecules, damaged organelles, and misfolded protein aggregates in response to diverse stimuli, including infection. Autophagy acts to limit intracellular microbial growth but intracellular pathogens have evolved strategies to subvert host autophagic responses for their survival. We found that Listeria monocytogenes ActA, a surface protein required for actin polymerization and actin-based bacterial motility, plays a pivotal role in evading autophagy, but in a manner independent of bacterial motility. We show that L. monocytogenes exploits the bi...
Source: Autophagy - October 27, 2009 Category: Cytology Authors: Yoshikawa Y, Ogawa M, Hain T, Chakraborty T, Sasakawa C Tags: Autophagy Source Type: journals

FabH selectivity for anteiso branched-chain fatty acid precursors in low-temperature adaptation in Listeria monocytogenesEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Gram-positive bacteria, including Listeria monocytogenes, adjust membrane fluidity by shortening the fatty acid chain length and increasing the proportional production of anteiso fatty acids at lower growth temperatures. The first condensation reaction in fatty acid biosynthesis is carried out by [beta]-ketoacyl-acyl carrier protein synthase III (FabH), which determines the type of fatty acid produced in bacteria. Here, we measured the initial rates of FabH-catalyzed condensation of malonyl-acyl carrier protein and alternate branched-chain precursor acyl-CoAs utilizing affinity-purified His-tagged L. monocytogenes FabH het...
Source: FEMS Microbiology Letters - October 27, 2009 Category: Microbiology Authors: Atul K. Singh, Yong-Mei Zhang, Kun Zhu, Chitra Subramanian, Zhong Li, Radheshyam K. Jayaswal, Craig Gatto, Charles O. Rock, Brian J. Wilkinson Source Type: journals

Synthesis of Iron Oxide Nanoparticles in Listeria innocua Dps (DNA-Binding Protein from Starved Cells): A Study with the Wild-Type Protein and a Catalytic Centre Mutant.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
A comparative analysis of the magnetic properties of iron oxide nanoparticles grown in the cavity of the DNA-binding protein from starved cells of the bacterium Listeria innocua, LiDps, and of its triple-mutant lacking the catalytic ferroxidase centre, LiDps-tm, is presented. TEM images and static and dynamic magnetic and electron magnetic resonance (EMR) measurements reveal that, under the applied preparation conditions, namely alkaline pH, high temperature (65 degrees C), exclusion of oxygen, and the presence of hydrogen peroxide, maghemite and/or magnetite nanoparticles with an average diameter of about 3 nm are min...
Source: Chemistry - October 26, 2009 Category: Chemistry Authors: Ceci P, Chiancone E, Kasyutich O, Bellapadrona G, Castelli L, Fittipaldi M, Gatteschi D, Innocenti C, Sangregorio C Tags: Chemistry Source Type: journals

Selenium deficiency impairs host innate immune response and induces susceptibility to Listeria monocytogenes infectionEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Conclusion: In conclusion, induced susceptibility of host resistance is associated with an impaired innate immune response following infection with L. monocytogenes in C57BL/6 Se-deficient mice. (Source: BMC Immunology)
Source: BMC Immunology - October 23, 2009 Category: Allergy & Immunology Authors: Chengmin WangHaijing WangJing LuoYi HuLei WeiMingxing DuanHongxuan He Source Type: journals

Effect of Salt, Smoke Compound, and Temperature on the Survival of Listeria monocytogenes in Salmon during Simulated Smoking ProcessesEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
The objectives of this study were to examine and develop a model to describe the survival of Listeria monocytogenes in salmon as affected by salt, smoke compound (phenol), and smoking process temperature. Cooked minced salmon containing selected levels of salt (0%, 2%, 4%, and 6%) and smoke compound (0, 5, 10, and 15 ppm phenol) were inoculated with a 6-strain mixture of L. monocytogenes to an inoculum level of 6.0 log10 CFU/g. The populations of L. monocytogenes in salmon during processing at 40, 45, 50, and 55 °C that simulated cold- and hot-smoking process temperatures were determined, and the effects of salt, phenol, ...
Source: Journal of Food Science - October 21, 2009 Category: Food Science Authors: Cheng-An Hwang, Shiowshuh Sheen, Vijay K. Juneja Source Type: journals

Comparison of different application strategies of divergicin M35 for inactivation of Listeria monocytogenes in cold-smoked wild salmon.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Cold-smoked salmon treated with divergicin M35-producing Carnobacterium divergens M35, C. divergens ATCC 35677 (a non-producer of bacteriocin), purified divergicin M35 or supernatants of C. divergens M35 culture in snow crab hepatopancreas (SCH) medium or MRS broth was challenged with Listeria monocytogenes (up to 10(3) CFU/g). Samples were stored at 4 degrees C for up to four weeks. L. monocytogenes, total bacterial and lactic acid bacterial counts were determined along with changes in total volatile base nitrogen (TVBN) and biogenic amine production as well as texture, color and odor. A 2.6 log CFU/g reduction in L. ...
Source: Food Microbiology - October 21, 2009 Category: Food Science Authors: Tahiri I, Desbiens M, Kheadr E, Lacroix C, Fliss I Tags: Food Microbiol Source Type: journals

Role of quantity and quality of fat in meat models inoculated with Listeria innocua or Salmonella Typhimurium treated by high pressure and refrigerated stored.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Several variables can influence the effects of high hydrostatic pressure processing (HPP), but the role of fat in the treated sample is still uncertain. We designed a model by which controlling the known variables we could elucidate that role. We applied 400 MPa for 2 min to minced chicken samples inoculated with Listeria innocua and Salmonella Typhimurium mixed with 10% and 20% of three fat types with different fatty acid composition. Microbial counts were performed during 60 days of refrigerated storage either at 2 degrees C or 8 degrees C. Immediately after HPP bacterial growth was independent of the type and percen...
Source: Food Microbiology - October 21, 2009 Category: Food Science Authors: Escriu R, Mor-Mur M Tags: Food Microbiol Source Type: journals

Inhibition by Lactobacillus sakei of other species in the flora of vacuum packaged raw meats during prolonged storage.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
The abilities of five Lactobacillus sakei strains and one Lactococcus lactis strain to retain inhibitory activity against several target organisms in the flora of product during 12 weeks storage of vacuum-packaged lamb and beef was investigated. L. sakei strains were generally found capable of developing dominant populations on both beef and lamb. L. lactis 75 grew poorly on lamb did not inhibit co-inoculated Brochothrix thermosphacta. Lamb inoculated with the Sakacin-A producer L. sakei Lb706 had lower Listeria monocytogenes populations than lamb inoculated with a bacteriocin-negative variant. In beef packs inoculated...
Source: Food Microbiology - October 21, 2009 Category: Food Science Authors: Jones RJ, Zagorec M, Brightwell G, Tagg JR Tags: Food Microbiol Source Type: journals

Resistance of Listeria monocytogenes, Escherichia coli O157:H7 and Campylobacter jejuni after exposure to repetitive cycles of mild bactericidal treatments.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
While maintaining nutritional and sensorial attributes of fresh foods mild processing technologies generally deliver microbiologically perishable food products. Currently little information exists on possible increase in the resistance of pathogens after repetitive exposure to mild (sub-lethal) treatments. Multiple strain-cocktails of Listeria monocytogenes, Escherichia coli O157:H7 and Campylobacter jejuni were exposed to 20 consecutive cycles of sub-lethal inactivation by three different techniques. Used techniques comprised inactivation with lactic acid (LA), chlorine dioxide (ClO(2)) and intense light pulses (ILP)....
Source: Food Microbiology - October 21, 2009 Category: Food Science Authors: Rajkovic A, Smigic N, Uyttendaele M, Medic H, de Zutter L, Devlieghere F Tags: Food Microbiol Source Type: journals

Comparative analysis of acid resistance in Listeria monocytogenes and Salmonella enterica strains before and after exposure to poultry decontaminants. Role of the glutamate decarboxylase (GAD) system.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
This study was undertaken in order to compare the survival rates in acid broths of Listeria monocytogenes and Salmonella enterica strains, both exposed to and not exposed to decontaminants. The contribution of the glutamate decarboxylase (GAD) acid resistance system to the survival of bacteria in acid media was also examined. Four strains (L. monocytogenes serovar 1/2, L. monocytogenes serovar 4b, S. enterica serotype Typhymurium and S. enterica serotype Enteritidis) were tested before (control) and after exposure to trisodium phosphate, acidified sodium chlorite, citric acid, chlorine dioxide and peroxyacids (strains were...
Source: Food Microbiology - October 21, 2009 Category: Food Science Authors: Alonso-Hernando A, Alonso-Calleja C, Capita R Tags: Food Microbiol Source Type: journals

Occurrence of foodborne pathogens in Irish farmhouse cheese.Email this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
Food safety is a critical factor in the production of farmhouse cheese. In Ireland the varieties of farmhouse cheese produced reflect a much broader range than those produced commercially and some of these cheese varieties are associated with greater microbiological risk. These include cheese produced from unpasteurised milk and soft ripened cheese such as mould or smear-ripened cheeses which have high pH and relatively short ripening times. The aim of this study was to determine the microbiological quality of farmhouse cheeses in Ireland. Three hundred and fifty one cheese samples, from 15 cheese producers, were analy...
Source: Food Microbiology - October 21, 2009 Category: Food Science Authors: O'Brien M, Hunt K, McSweeney S, Jordan K Tags: Food Microbiol Source Type: journals

Effect of Organic Acids and Plant Extracts on Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella Typhimurium in Broth Culture Model and Chicken Meat SystemsEmail this article to a colleague. Save this article to My Clippings. Discuss or comment on this article.
In this study, acetic (AA), citric acid (CA), lactic acid (LA), malic acid (MA), and tartaric acid (TA) and grape seed (GS), green tea (GT), bitter melon seed (BMS), rasum, and fenugreek (FG) extracts were investigated as inhibitors against S.T., L.m., and E.c. in both broth-culture and meat systems. Brain Heart Infusion solutions containing 18.7, 37.5, and 75.0 mM organic acids and 5, 10, 20, and 40 mg/mL extracts were challenged with approximately log 6 CFU/mL S.T., L.m., and E.c. A pH-adjusted control was included to determine pH effect on exhibited antibacterial activity. For the meat system, 1 to 2 g chicken breast pi...
Source: Journal of Food Science - October 20, 2009 Category: Food Science Authors: K.F. Over, N. Hettiarachchy, M.G. Johnson, B. Davis Source Type: journals