Microbiology
This is an RSS file. You can use it to subscribe to this data in your favourite RSS reader, such as GoogleReader, or to display this data on your own website or blog.
Subscribe to this data using MyMedWorm.
Subscribe to this data using GoogleReader.
Subscribe to this data using Bloglines.
Subscribe to this data using MyYahoo.
Get the very latest Swine Flu news via the MedWorm Swine Flu RSS news feed - updated hourly from thousands of authoritative health and news sources.
This page shows you the latest items in this publication.
415 records returned
Integrating Multiple "Omics" Analysis for Microbial Biology: Application and Methodologies.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Recent advances in various "omics" technologies enable quantitative monitoring of the abundance of various biological molecules in a high throughput manner, and thus allow determination of their variation between different biological states on a genomic scale. Several popular "omics" platforms that have been used in microbial systems biology include: transcriptomics that measures messenger RNA transcript levels, proteomics that quantifies protein abundance, metabolomics that determines abundance of small cellular metabolites, interactomics that resolves the whole set of molecular interactions in cells, and fluxomics th...
Source: Microbiology - November 12, 2009 Category: Microbiology Authors: Zhang W, Li F, Nie L Tags: Microbiology Source Type: journals
Poly(A) polymerase 1 (PAP1) homozygosity and hyperadenylation are major determinants of increased mRNA stability of CDR1 in azole resistant clinical isolates of Candida albicans.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
This study examines the molecular mechanisms underlying enhanced CDR1 mRNA stability in AR isolates. Mapping of the 3'UTR of CDR1 revealed that it was rich in 'AU' (Adenylate-Uridylate) elements, possessed heterogeneous polyadenylation sites, and had putative consensus sequences for RNA-binding proteins. Swapping of heterologous and chimeric lacZ-CDR1 3'UTR transcriptional reporter fusion constructs did not alter the reporter activity in AS and AR isolates, indicating that cis-acting sequences within the CDR1 3'UTR itself are not sufficient to confer the observed differential mRNA decay. Interestingly, the poly(A) tail of ...
Source: Microbiology - November 12, 2009 Category: Microbiology Authors: Manoharlal R, Gorantala J, Sharma M, Sanglard D, Prasad R Tags: Microbiology Source Type: journals
Analysis of adherence, biofilm formation, and cytotoxicity suggest a greater virulence potential of Gardnerella vaginalis relative to other bacterial vaginosis-associated anaerobes.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
This study suggests that G. vaginalis is more virulent than other BV-associated anaerobes, and that many of the bacterial species frequently isolated from BV may be relatively avirulent opportunists that colonize the vagina after G. vaginalis has initiated an infection.
PMID: 19910411 [PubMed - as supplied by publisher] (Source: Microbiology)
Source: Microbiology - November 12, 2009 Category: Microbiology Authors: Patterson JL, Stull-Lane A, Girerd PH, Jefferson KK Tags: Microbiology Source Type: journals
Autophagy is Involved in Starvation Response and Cell Death in Blastocystis.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
In this study, we investigated if Blastocystis underwent autophagy upon amino acid starvation and rapamycin treatment. Concurrently, we have provided new insight on a possible function of the central vacuole. The use of autophagic marker monodansylcadaverine (MDC) and autophagic inhibitor 3-methyladenine and wortmannin showed the existence of autophagy in amino acid-starved and rapamycin-treated Blastocystis. Confocal microscopy and transmission electron microscopic studies also showed morphological changes suggestive of autophagy. The unusually large size of the autophagic compartments within the parasite central vacuole ...
Source: Microbiology - November 12, 2009 Category: Microbiology Authors: Yin J, Ye AJ, Tan KS Tags: Microbiology Source Type: journals
A 2-oxoacid dehydrogenase complex of Haloferax volcanii is essential for growth on isoleucine but not the other branched chain amino acids.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
The halophilic archaeon Haloferax volcanii contains three operons encoding 2-oxoacid dehydrogenase complexes (OADHCs), OADHC1 to OADHC3. However, the biological role of none of the three OADHCs is known, since previous studies had come to the conclusion that they cannot use any of the known OADHC substrates. Even the construction of single mutants in all three oadhc operons, reported recently, could not lead to the identification of a substrate. Therefore, all three possible double mutants and a triple mutant were generated, and single, double and triple mutants were compared to the wildtype. The four mutants devoid of...
Source: Microbiology - November 12, 2009 Category: Microbiology Authors: Sisignano M, Morbitzer D, Gägens J, Oldiges M, Soppa J Tags: Microbiology Source Type: journals
Role of Host Cell Polarity and Leading Edge Properties in Pseudomonas Type III Secretion.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Type III secretion (T3S) functions in establishing infections in a large number of Gram-negative bacteria, yet little is known about how host cell properties might function in this process. We used the opportunistic pathogen, Pseudomonas aeruginosa, and the ability to alter host cell sensitivity to Pseudomonas T3S to explore this problem. HT-29 epithelial cells were used to study cellular changes associated with loss of T3S sensitivity, which could be induced by treatment with methyl-beta-cyclodextrin or perfringolysin O. HL-60 promyelocytic cells are innately resistant to Pseudomonas T3S and were used to study cellula...
Source: Microbiology - November 12, 2009 Category: Microbiology Authors: Bridge DR, Novotny MJ, Moore ER, Olson JC Tags: Microbiology Source Type: journals
Quorum Sensing Regulated Virulence factors in Pseudomonas aeruginosa are toxic to Lucilia sericata maggots.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Maggot debridement therapy (MDT) is widely used for debridement of chronic infected wounds, however for wounds harbouring specific bacteria limited effect or failure of the treatment have been described. Here we study the survival of Lucilia sericata maggots encountering Pseudomonas aeruginosa (PAO1) in a simple assay with emphasis on the quorum sensing (QS) regulated virulence. The maggots were challenged with GFP tagged P.aeruginosa WT PAO1 and GFP tagged P. aeruginosa DeltalasR rhlR (DeltaRR) QS deficient mutants in different concentrations. Maggots were killed in the presence of WT PAO1 whereas the challenge with t...
Source: Microbiology - November 5, 2009 Category: Microbiology Authors: Andersen AS, Jørgensen B, Bjarnsholt T, Johansen H, Karlsmark T, Givskov M, Krogfelt KA Tags: Microbiology Source Type: journals
Listeria monocytogenes does not survive ingestion by Acanthamoeba polyphaga.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
This study used short-term co-culture at 15, 22 and 37 degrees C to examine the interaction L. monocytogenes strains with Acanthamoeba polyphaga (ACO12). Survival of L. monocytogenes cells phagocytosed by monolayers of trophozoites was assessed by culture techniques and microscopy. A. polyphaga trophozoites eliminated bacterial cells within few hours post phagocytosis irrespective of the incubation temperature used. Wild-type L. monocytogenes and phenotypic listeriolysin O mutants were unable to either multiply or survive within trophozoites. By contrast, Salmonella enterica serovar Typhimurium C5 cells used as controls we...
Source: Microbiology - November 5, 2009 Category: Microbiology Authors: Akya A, Pointon A, Thomas C Tags: Microbiology Source Type: journals
The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition ...
Source: Microbiology - November 5, 2009 Category: Microbiology Authors: van der Veen S, van Schalkwijk S, Molenaar D, de Vos WM, Abee T, Wells-Bennik MH Tags: Microbiology Source Type: journals
Genome diversity in Fructobacillus, Leuconostoc and Weissella genera through physical and genetic mapping.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Pulsed-field gel electrophoresis analysis of chromosomal single and double restriction profiles of 17 strains belonging to three "Leuconostocaceae" genera was done, resulting in physical and genetic maps for 3 Fructobacillus, 6 Leuconostoc and 4 Weissella strains. AscI, I-CeuI, NotI and SfiI restriction enzymes were used together with Southern hybridization of selected probes to provide an assessment of genomic organization diversity in different species. Estimated genome sizes varied from 1408 kb to 1547 kb in Fructobacillus, 1644 kb to 2133 kb in Leuconostoc and from 1371 kb to 2197 kb in Weissella. Other genomic cha...
Source: Microbiology - November 5, 2009 Category: Microbiology Authors: Chelo IM, Zé-Zé L, Tenreiro R Tags: Microbiology Source Type: journals
Differences in adherence and virulence gene expression between two outbreak strains of enterohemorrhagic Escherichia coli O157:H7.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
The Escherichia coli O157:H7 TW14359 strain was implicated in a multi-state outbreak in North America in 2006, which resulted in high rates of severe disease. Similarly, the O157:H7 RIMD0509952 (Sakai) strain caused the largest O157:H7 outbreak to date. Both strains were shown to represent divergent phylogenetic lineages. Here we compared global gene expression patterns before and after epithelial cell exposure as well as the ability to adhere to and invade epithelial cells between the two outbreak strains. Epithelial cell assays demonstrated a 2.5 fold increase in adherence of the TW14359 strain relative to Sakai, whi...
Source: Microbiology - November 5, 2009 Category: Microbiology Authors: Abu-Ali GS, Ouellette LM, Henderson ST, Whittam TS, Manning SD Tags: Microbiology Source Type: journals
Regulation of Valanimycin Biosynthesis in Streptomyces viridifaciens: Characterization of VlmI as a Streptomyces Antibiotic Regulatory Protein (SARP).
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Streptomyces antibiotic regulatory proteins (SARPs) have been shown to activate transcription by binding to a tandemly arrayed set of heptameric, direct repeats located around the -35 region of their cognate promoters. Experimental evidence showing that VlmI is a regulatory gene in the valanimycin biosynthetic gene cluster of Streptomyces viridifaciens and encodes for a protein belonging to the SARP family is presented here. The organization of the valanimycin biosynthetic gene cluster suggests that the valanimycin biosynthetic genes are located on three potential transcripts, vlmHORBCD, vlmJKL, and vlmA. Disruption of...
Source: Microbiology - November 5, 2009 Category: Microbiology Authors: Garg RP, Parry RJ Tags: Microbiology Source Type: journals
From spores to antibiotics via the cell cycle.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Spore formation in Bacillus subtilis is a superb experimental system with which to study some of the most fundamental problems of cellular development and differentiation. Work begun in the 1980's and ongoing today has led to an impressive understanding of the temporal and spatial regulation of sporulation, and the functions of many of the several hundred genes involved. Early in sporulation the cells divide in an unusual asymmetric manner, to produce a small prespore cell and a much larger mother cell. Aside from developmental biology, this modified division has turned out to be a powerful system for investigation of ...
Source: Microbiology - November 5, 2009 Category: Microbiology Authors: Errington J Tags: Microbiology Source Type: journals
Alternate Isoleucine Synthesis Pathway in Cyanobacterial Species.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Cyanothece sp. ATCC 51142 is an aerobic N(2)-fixing and hydrogen-producing cyanobacterium. Isotopomer analysis of its amino acids reveals an identical labeling profile for leucine and isoleucine when Cyanothece 51142 is grown mixotrophically using [2-(13)C] labeled glycerol as the main carbon source. This indicates that Cyanothece 51142 employs the atypical alternative citramalate pathway for isoleucine synthesis with pyruvate and acetyl-CoA as precursors. Utilization of the citramalate pathway is confirmed by an enzyme assay and LC-MS/MS analysis. Furthermore, the genome sequence of Cyanothece 51142 shows that the gen...
Source: Microbiology - October 29, 2009 Category: Microbiology Authors: Wu B, Zhang B, Feng X, Rubens JR, Huang R, Hicks LM, Pakrasi HB, Tang YJ Tags: Microbiology Source Type: journals
Ensifer, Phyllobacterium and Rhizobium species occupy nodules of Medicago sativa (alfalfa) and Melilotus alba (sweet clover) grown at a Canadian site without a history of cultivation.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Phage resistant and susceptible bacteria from nodules of alfalfa and sweet clover grown at a site without a known history of cultivation, were identified as diverse genotypes of Ensifer, Rhizobium and Phyllobacterium species based on sequence analysis of ribosomal (16S and 23S rRNA) and protein encoding (atpD and recA) genes, Southern hybridization/RFLP and a range of phenotypic characteristics. Among phage resistant bacteria, one genotype of Rhizobium sp. predominated on alfalfa (frequency c. 68%) but was recovered infrequently (c.1%) from sweet clover. A second genotype was isolated infrequently only from alfalfa. Th...
Source: Microbiology - October 29, 2009 Category: Microbiology Authors: Bromfield E, Tambong J, Cloutier S, Prevost D, Laguerre G, van Berkum P, Tran Thi TV, Assabgui R, Barran L Tags: Microbiology Source Type: journals
The inositol regulon controls viability in Candida glabrata.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Inositol is essential in eukaryotes, and must be imported or synthesized. Inositol biosynthesis in Saccharomyces cerevisiae is controlled by three nonessential genes that make up the inositol regulon: ScINO2 and ScINO4, which together encode a heterodimeric transcriptional activator, and ScOPI1, which encodes a transcriptional repressor. ScOpi1p inhibits the ScIno2-ScIno4p activator in response to extracellular inositol levels. An important gene controlled by the inositol regulon is ScINO1, which encodes inositol-3-phosphate synthase, a key enzyme in inositol biosynthesis. In the pathogenic yeast Candida albicans, homo...
Source: Microbiology - October 29, 2009 Category: Microbiology Authors: Bethea EK, Carver BJ, Montedonico AE, Reynolds TB Tags: Microbiology Source Type: journals
Identification and functional characterization of a gene for the methanol:N,N'-dimethyl-4-nitrosoaniline oxidoreductase from Mycobacterium sp. strain JC1 DSM 3803.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Mycobacterium sp. strain JC1 is able to grow on methanol as a sole source of carbon and energy using methanol:N,N'-dimethyl-4-nitrosoaniline oxidoreductase (MDO) as a key enzyme for primary methanol oxidation. Purified MDO oxidizes ethanol and formaldehyde as well as methanol. The Mycobacterium sp. strain JC1 gene for MDO (mdo) was cloned, sequenced, and determined to have an open reading frame of 1272 bp. Northern blot and promoter analysis revealed that the mdo transcription was induced in cells grown in the presence of methanol. Northern blot together with RT-PCR also showed that the mdo gene was transcribed as mono...
Source: Microbiology - October 29, 2009 Category: Microbiology Authors: Park H, Lee H, Ro YT, Kim YM Tags: Microbiology Source Type: journals
Epidemiology, variable genetic organisation and regulation of the EDIN-B toxin in Staphylococcus aureus from bacteraemic patients.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
EDIN-B (Epidermal cell Differentiation INhibitor-B; also termed C3Stau) is an exotoxin of S. aureus which ADP-ribosylates and inactivates Rho GTP-binding proteins. The EDIN-B gene (edin-B) and the gene for exfoliative toxin D (etd) make up the central part of a recently described pathogenicity island. Here we evaluated the prevalence and genetic organisation of the edin-B/etd pathogenicity island in invasive S. aureus isolates and characterized edin-B transcription and EDIN-B production using artificial constructs transduced in S. aureus strains RN6390 and -Newman. We found that 8 out of 121 (7 %) S. aureus blood cultu...
Source: Microbiology - October 29, 2009 Category: Microbiology Authors: Franke GC, Böckenholt A, Sugai M, Rohde H, Aepfelbacher M Tags: Microbiology Source Type: journals
Sugar source modulates exopolysaccharide biosynthesis in Bifidobacterium longum subsp. longum CRC 002.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
The effect of four sugars (glucose, galactose, lactose, and fructose) on EPS production by B. longum subsp. longum CRC 002 was evaluated. More EPS was produced when CRC 002 was grown on lactose in the absence of pH control with a production of 1080 +/- 120 mg EPS l-1 (p < 0.01) after 24 h of incubation. For fructose, galactose and glucose, EPS production was similar at 512 +/- 63 mg EPS l-1, 564 +/- 165 mg EPS l-1 and 612 +/- 93 mg EPS l-1, respectively. The proposed repeating unit composition of the EPS is 2 galactose to 3 glucose. The effect of sugar and fermentation time on expression of genes involved in sugar n...
Source: Microbiology - October 22, 2009 Category: Microbiology Authors: Audy J, Labrie S, Roy D, Lapointe G Tags: Microbiology Source Type: journals
Transcriptional and functional characterization of the gene coding for acyl carrier protein from Bacillus subtilis.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Acyl carrier protein (ACP) is a universal and highly conserved carrier of acyl intermediates during fatty acid biosynthesis. The molecular mechanism of regulation of the acpP structural gene as well as the function of its gene product is poorly characterized in Bacillus subtilis and other Gram-positive organisms. Here we report that transcription of acpP takes place from two different promoters, PfapR and PacpP. Expression of acpP from PfapR is coordinated with a cluster of genes involved in lipid synthesis (the fapR operon) constituted by fapR-plsX-fabD-fabG-acpP. PacpP is located immediately upstream of the acpP codi...
Source: Microbiology - October 22, 2009 Category: Microbiology Authors: Martinez MA, de Mendoza D, Schujman GE Tags: Microbiology Source Type: journals
Molecular Typing of Mycobacterium intracellulare using Multilocus Variable-Number of Tandem-Repeat Analysis: Identification of Loci and Analysis of Clinical Isolates.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
In addition to its known status as a disseminated disease in HIV-positive patients, Mycobacterium avium complex (MAC) is increasingly recognized as a causative pathogen of respiratory disease in HIV-negative patients. MAC is divided into Mycobacterium avium, and the less-epidemiologically studied Mycobacterium intracellulare. Genetic typing for M. intracellulare using variable number of tandem repeats (VNTR) has not yet been developed. The aim of this study was to identify VNTR loci in the genome of Mycobacterium intracellulare and apply them as an epidemiological tool to clinical isolates. Here, we identified 25 VNTR ...
Source: Microbiology - October 22, 2009 Category: Microbiology Authors: Ichikawa K, Yagi T, Inagaki T, Moriyama M, Nakagawa T, Uchiya KI, Nikai T, Ogawa K Tags: Microbiology Source Type: journals
Study of the distribution of autotrophic CO2 fixation cycles in Crenarchaeota.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Two new autotrophic carbon fixation cycles were recently described in Crenarchaeota. The 3-hydroxypropionate/4-hydroxybutyrate cycle using acetyl-coenzyme A (CoA)/propionyl-CoA carboxylase as the carboxylating enzyme was shown for (micro)aerobic members of the Sulfolobales. The dicarboxylate/4-hydroxybutyrate cycle using oxygen-sensitive pyruvate synthase and phosphoenolpyruvate carboxylase as carboxylating enzymes was found in members of the anaerobic Desulfurococcales and Thermoproteales. However, Sulfolobales harbor anaerobic and Desulfurococcales aerobic autotrophic representatives, raising the question which of th...
Source: Microbiology - October 22, 2009 Category: Microbiology Authors: Berg IA, Ramos-Vera WH, Petri A, Huber H, Fuchs G Tags: Microbiology Source Type: journals
Purification and characterization of a clostripain-like protease from a recombinant Clostridium perfringens culture.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Clostridium perfringens produces a homologue of clostripain (Clo), the arginine-specific endopeptidase of Clostridium histolyticum. To determine the biochemical and biological properties of the C. perfringens homologue (Clp), it was purified from the culture supernatant of a recombinant C. perfringens strain by cation exchange chromatography and ultrafiltration. Analysis by SDS-PAGE, N-terminal amino acid sequencing and TOF mass spectrometry revealed that Clp consists of two polypeptides comprising heavy (38-kDa) and light (16-kDa or 15-kDa) chains, and that the two light chains differ in the N-terminal cleavage site. ...
Source: Microbiology - October 22, 2009 Category: Microbiology Authors: Manabe S, Nariya H, Miyata S, Tanaka H, Minami J, Suzuki M, Taniguchi Y, Okabe A Tags: Microbiology Source Type: journals
Hydrophobic carboxy-terminal residues dramatically reduce protein levels in the haloarchaeon Haloferax volcanii.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Proteolysis is important not only to cell physiology but also to the successful development of biocatalysts. While a wide-variety of signals are known to trigger protein degradation in bacteria and eukaryotes, these mechanisms are poorly understood in archaea known for their ability to withstand harsh conditions. Here we present a systematic study in which single C-terminal amino acid residues were added to a reporter protein and shown to influence its levels in an archaeal cell. All twenty amino acid residues were examined for their impact on protein levels, using the reporter protein soluble modified red-shifted gree...
Source: Microbiology - October 22, 2009 Category: Microbiology Authors: Reuter CJ, Uthandi S, Puentes JA, Maupin-Furlow JA Tags: Microbiology Source Type: journals
Regulation of the dauBAR Operon and Characterization of D-Amino Acid Dehydrogenase DauA in Arginine and Lysine Catabolism of Pseudomonas aeruginosa PAO1.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
A unique D-to-L racemization of arginine by coupled arginine dehydrogenases DauA and DauB encoded by the dauBAR operon was recently reported as pre-requisite for D-arginine utilization as sole source of carbon and nitrogen through L-arginine catabolic pathways in P. aeruginosa. Here in this study, enzymatic properties of the catabolic FAD-dependent D-amino acid dehydrogenase DauA and the physiological functions of the dauBAR operon were further characterized with other D-amino acids. These results establish DauA as D-amino acid dehydrogenase of broad substrate specificity, with D-Arg and D-Lys as the two most effective...
Source: Microbiology - October 22, 2009 Category: Microbiology Authors: Li C, Yao X, Lu CD Tags: Microbiology Source Type: journals
The hrcA and hspR regulons of Campylobacter jejuni.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
The human pathogen Campylobacter jejuni has a classic heat shock response, showing induction of chaperones and proteases plus several unidentified proteins in response to small increase in growth temperature. The genome contains two homologues to known heat shock response regulators, HrcA and HspR. Previous work has shown that HspR controls several heat shock genes, but the hrcA regulon has not been defined. We have constructed single and double deletions of C. jejuni hrcA and hspR and analysed gene expression using microarrays. Only a small number of genes are controlled by these two regulators, and the two regulons o...
Source: Microbiology - October 22, 2009 Category: Microbiology Authors: Holmes CW, Penn CW, Lund PA Tags: Microbiology Source Type: journals
Characterization of a virulent and cell-wall-located deoxyribonuclease of Streptococcus pyogenes.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
We investigated culture supernatant proteins from the M1 serotype Streptococcus pyogenes by 2-dimensional gel electrophoresis and peptide mass mapping analysis, and we characterized the single protein spots. Among them, we analyzed the Spy0747 protein. This protein is homologous to the SsnA protein, which is a cell-wall-located DNase expressed in S. suis serotype 2. We designated the Spy0747 protein as SpnA. SpnA protein was also detected in the insoluble fraction of whole cell lysates using shotgun proteomic analysis and this result suggests that SpnA is also located in the cell wall. SpnA was expressed as a glutathio...
Source: Microbiology - October 22, 2009 Category: Microbiology Authors: Hasegawa T, Minami M, Okamoto A, Tatsuno I, Isaka M, Ohta M Tags: Microbiology Source Type: journals
New insights into the regulatory networks of paralogous genes.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Extensive genomic studies on gene duplication in model organisms, such as Escherichia coli and Saccharomyces cerevisiae have recently been undertaken. In these models, it is commonly considered that a duplication event may include a Transcription Factor (TF), a Target Gene (TG), or both. Following a gene duplication episode, varying scenarios have been postulated to describe the evolution of the regulatory network. However in most of these, the TFs have emerged as the most important and in some cases the only factor shaping the regulatory network as the organism responds to a natural selection process, in order to fulf...
Source: Microbiology - October 22, 2009 Category: Microbiology Authors: Martínez-Núñez MA, Pérez-Rueda E, Gutierréz-Ríos RM, Merino E Tags: Microbiology Source Type: journals
Fungal physiology and the origins of molecular biology.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Molecular biology has several distinct origins, but especially important are those contributed by fungal and yeast physiology, biochemistry, and genetics. From the first gene action studies that became the basis of our understanding of the relationship between genes and proteins, through chromosome structure, mitochondrial genetics and membrane biogenesis, gene silencing, and circadian clocks, studies with these organisms have yielded basic insight into these processes applicable to all eukaryotes. Examples are cited of pioneering studies with fungi that have stimulated new research in clinical medicine and agriculture...
Source: Microbiology - October 22, 2009 Category: Microbiology Authors: Brambl R Tags: Microbiology Source Type: journals
Fungal Physiology - A Future Perspective.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
The study of fungal physiology is set to change dramatically in the next few years as highly scalable technologies are deployed allowing accurate measurement and identification of metabolites, proteins and transcripts within cells. The advent of next generation DNA sequencing technologies will also provide genome sequence information from large numbers of industrially relevant and pathogenic fungal species, and allow comparative genome analysis between strains and populations of fungi. When coupled with advances in gene functional analysis, protein-protein interaction studies, live cell imaging and mathematical modelin...
Source: Microbiology - October 22, 2009 Category: Microbiology Authors: Wilson RA, Talbot NJ Tags: Microbiology Source Type: journals
Genetic determinants of Pseudomonas aeruginosa biofilm establishment.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
The establishment of bacterial biofilms on surfaces is a complex process that requires various factors for each consecutive developmental step. Here we report the screen of the comprehensive Harvard Pseudomonas aeruginosa PA14 mutant library for mutants exhibiting an altered biofilm phenotype. We analyzed the capability of all mutants to form biofilms at the bottom of a 96-well plate by the use of an automated confocal laser scanning microscope and uncovered 394 and 285 genetic determinants of reduced and enhanced biofilm production, respectively. Overall, 67% of the identified mutants were affected within genes encodi...
Source: Microbiology - October 22, 2009 Category: Microbiology Authors: Müsken M, Difiore S, Dötsch A, Fischer R, Haussler S Tags: Microbiology Source Type: journals
Carbonic anhydrases in fungi.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Carbonic anhydrases (CAs) are metalloenzymes that catalyze the interconversion of carbon dioxide and bicarbonate with high efficiency. This reaction is fundamental to biological processes such as respiration, photosynthesis, pH homeostasis, CO(2) transport and electrolyte secretion. CAs are distributed among all three domains of life, and are currently divided into five evolutionarily unrelated classes (alpha, beta, gamma, delta and zeta). Fungal CAs have only recently been identified and characterized in detail. While Saccharomyces cerevisiae and Candida albicans each have only one beta-CA, multiple copies of beta-CA-...
Source: Microbiology - October 14, 2009 Category: Microbiology Authors: Elleuche S, Pöggeler S Tags: Microbiology Source Type: journals
Processing, Assembly, and Localization of a Bacillus anthracis Spore Protein.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
All Bacillus spores are encased in macromolecular shells. One of these is a proteinacious shell called the coat that, in Bacillus subtilis, provides critical protective functions. The Bacillus anthracis spore is the infectious particle for the disease anthrax. Therefore, the coat is of particular interest because it may provide essential protective functions required for the appearance of anthrax. Here, we analyze a protein component of the spore outer layers that was previously designated as BxpA. Our data indicate that a significant amount of BxpA is located below the spore coat and associated with the cortex. By SDS...
Source: Microbiology - October 14, 2009 Category: Microbiology Authors: Moody KL, Driks A, Rother GL, Cote CK, Brueggemann EE, Hines HB, Friedlander AM, Bozue JA Tags: Microbiology Source Type: journals
Attraction of Brachyspira pilosicoli to mucin.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
The anaerobic intestinal spirochaete Brachyspira pilosicoli colonises the large intestine of various species, including human beings. In the colon the spirochaete can penetrate the overlying mucus layer, attach by one cell end to the underlying enterocytes, and initiate localised colitis and diarrhoea. The aim of this study was to investigate whether, as part of the colonisation process, B. pilosicoli is attracted to mucin. Fifteen B. pilosicoli strains isolated from humans, pigs, chickens and dogs, and a control strain of Brachyspira hyodysenteriae, were analysed for their ability to enter solutions of hog gastric muc...
Source: Microbiology - October 14, 2009 Category: Microbiology Authors: Naresh R, Hampson DJ Tags: Microbiology Source Type: journals
A Previously Uncharacterized Gene, yjfO (bsmA) Influences Escherichia coli Biofilm Formation and Stress Response.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Bacteria growing as surface-adherent biofilms are better able to withstand chemical and physical stresses than their unattached, planktonic counterparts. Using transcriptional profiling and quantitative PCR, we observed a previously uncharacterized gene, yjfO, to be upregulated during Escherichia coli MG1655 biofilm growth in a chemostat on serine-limited defined medium. A yjfO mutant, developed through targeted insertion mutagenesis, and a yjfO-complemented strain, were obtained for further characterization. While bacterial surface colonization levels (CFU/cm2) were similar in all three strains, the mutant strain exhi...
Source: Microbiology - October 14, 2009 Category: Microbiology Authors: Weber MM, French CL, Barnes MB, Siegele DA, McLean RJ Tags: Microbiology Source Type: journals
VEJ{varphi}, a novel filamentous phage of Vibrio cholerae able of transducing the cholera toxin genes.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
A novel filamentous bacteriophage, designated VEJvarphi, was isolated from the strain MO45 of Vibrio cholerae of the O139 serogroup. A molecular characterization of the phage was carried out, which included the sequencing of its whole genome, the study of the genomic structure, the identification of the phage receptor, as well as the determination of the function of some genes, such as those encoding the major capsid protein and the single-stranded DNA binding proein. The genome nucleotide sequence of VEJvarphi, which consists of 6842 bp, revealed that it is organized in modules of functionally related genes in an arra...
Source: Microbiology - October 14, 2009 Category: Microbiology Authors: Campos J, Martínez E, Izquierdo Y, Fando RA Tags: Microbiology Source Type: journals
An observational study of the microbiome of the maternal pouch and saliva of the tammar wallaby, Macropus eugenii and of the gastrointestinal tract of the pouch young.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
In this study we used a well established marsupial model animal, Macropus eugenii, the tammar wallaby, to document the microbiome of three related sites: the maternal pouch and saliva and the gastrointestinal tract (GIT) of the young animal. We used molecular based methods targeting the 16S rDNA gene to determine the bacterial diversity at these study sites. In the maternal pouch, 41 unique phylotypes, predominantly belonging to the phylum Actinobacteria were detected, while in the saliva 48 unique phylotypes were found that predominantly belonged to the phylum Proteobacteria. The GIT of the pouch young had a complex micro...
Source: Microbiology - October 14, 2009 Category: Microbiology Authors: Chhour KL, Hinds LA, Jacques NA, Deane EM Tags: Microbiology Source Type: journals
Myo-inositol transport by Salmonella enterica serovar Typhimurium.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
In Salmonella enterica serovar Typhimurium, the genomic island GEI4417/4436 has recently been identified to be responsible for myo-inositol (MI) utilization. Here, two of the four island-encoded permeases are reported as the MI transporters of this pathogen. In-frame deletion of iolT1 (STM4418) led to severe, inactivation of iolT2 (STM4419) to slight growth deficiencies in the presence of MI. These phenotypes could be complemented by providing the putative transporter genes in trans. Bioluminescence-based reporter assays demonstrated a strong induction of their promoters PiolT1 and of PiolT2 in the presence of MI but n...
Source: Microbiology - October 14, 2009 Category: Microbiology Authors: Kröger C, Stolz J, Fuchs TM Tags: Microbiology Source Type: journals
The resistance-nodulation-division efflux pump EmhABC influences the production of 2,4-diacetylphloroglucinol in Pseudomonas fluorescens 2P24.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
In conclusion, our results suggested that the EmhABC system is an important element influencing the production of antibiotic 2,4-DAPG and for enhancing resistance to toxic compounds in P. fluorescens 2P24.
PMID: 19833777 [PubMed - as supplied by publisher] (Source: Microbiology)
Source: Microbiology - October 14, 2009 Category: Microbiology Authors: Tian T, Wu XG, Duan HM, Zhang LQ Tags: Microbiology Source Type: journals
Genetic and biochemical analysis of a class C nonspecific acid phosphatase (NSAP) of Clostridium perfringens.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
In this study, CPE0201, a putative acid phosphatase gene deduced by genome analysis, was shown to encode the nonspecific acid phosphatase in C. perfringens. Multiple alignments of the amino acid sequence showed that CPE0201 shares two signature motifs that belong to a class C acid phosphatase family. Expression of CPE0201 was shown to be positively regulated by the global VirR/VirS-VR-RNA regulatory cascade at the transcriptional level. To determine CPE0201's acid phosphatase activity, cloning, expression, purification and several biochemical characterizations of CPE0201 were carried out to reveal related properties. The o...
Source: Microbiology - October 14, 2009 Category: Microbiology Authors: Wang R, Ohtani K, Wang Y, Yuan Y, Hassan S, Shimizu T Tags: Microbiology Source Type: journals
The effect of sub-inhibitory concentrations of benzalkonium chloride on the competitiveness of Pseudomonas aeruginosa grown in continuous culture.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
This study investigates the link between adaptation to biocides and antibiotics in Pseudomonas aeruginosa. An enrichment continuous culture of P. aeruginosa NCIMB 10421 (MIC: 25 mg BKC l-1) was operated (D = 0.04 h-1, 792 h) with added benzalkonium chloride (BKC). A derivative, PA-29, (696 h), demonstrated a >12-fold decrease in sensitivity to the biocide (MIC: > 350 mg BKC l-1). The variant demonstrated a 256-fold increase in resistance to ciprofloxacin, with a mutation in the gyrA gene (Thr-83-->Ile). Similarly, culturing of the original strain in a continuous culture system with ciprofloxacin selection pressure...
Source: Microbiology - October 7, 2009 Category: Microbiology Authors: McCay PH, Ocampo-Sosa AA, Fleming GT Tags: Microbiology Source Type: journals
Defects in flagellin glycosylation affect the virulence of Pseudomonas syringae pv. tabaci 6605.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Flagellar motility and its glycosylation are indispensable for the virulence of Pseudomonas syringae pv. tabaci 6605. Six serine residues of flagellin protein at positions 143, 164, 176, 183, 193, and 201 are glycosylated, and the glycan structure at 201 was determined to consist of a trisaccharide of two L-rhamnosyl residues and a modified 4-amino-4,6-dideoxyglucosyl (viosamine) residue. To investigate the glycan structures attached to the other serine residues and to identify the important glycans for virulence, Ser/Ala-substituted mutants were generated. Six mutant strains that each retained a single glycosylated se...
Source: Microbiology - October 7, 2009 Category: Microbiology Authors: Taguchi F, Yamamoto M, Ohnishi-Kameyama M, Iwaki M, Yoshida M, Ishii T, Konishi T, Ichinose Y Tags: Microbiology Source Type: journals
The Bam (Omp85) complex is involved in secretion of the autotransporter haemoglobin protease.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Autotransporters are large virulence factors secreted by Gram-negative bacteria. They are synthesized with a C-terminal domain that forms a beta-barrel pore in the outer membrane implicated in translocation of the upstream 'passenger' domain across the outer membrane. However, recent structural data suggest that the diameter of the beta-barrel pore is not sufficient to allow the passage of partly folded structures observed for several autotransporters. Here, we have used a stalled translocation intermediate of the autotransporter Hbp to identify components involved in insertion and translocation of the protein across t...
Source: Microbiology - October 7, 2009 Category: Microbiology Authors: Sauri A, Soprova Z, Wickström D, de Gier JW, Van der Schors RC, Smit AB, Jong WS, Luirink J Tags: Microbiology Source Type: journals
SMc01553 is the sixth acyl carrier protein in Sinorhizobium meliloti 1021.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Acyl carrier proteins (ACPs) are required for the transfer of acyl intermediates during fatty acid and polyketide syntheses. In Sinorhizobium meliloti 1021 there are 5 known ACPs: AcpP, NodF, AcpXL, the ACP domain in RkpA and SMb20651. The genome sequence of S. meliloti 1021 also reveals the ORF SMc01553 annotated as putative ACP. Gene smc01553 is part of a 6.6 kb DNA region that is duplicated in the chromosome and in the pSymb plasmid which is the result of a recent duplication event. SMc01553 overexpressed in E. coli was labelled in vivo with [3H]beta-alanine, a biosynthetic building block of the 4'-phosphopantethein...
Source: Microbiology - September 30, 2009 Category: Microbiology Authors: Dávila-Martínez Y, Ramos-Vega AL, Contreras-Martínez S, Encarnación S, Geiger O, López-Lara IM Tags: Microbiology Source Type: journals
Nutrient-starved, non-replicating Mycobacterium tuberculosis requires respiration, ATP synthase and isocitrate lyase for maintenance of ATP homeostasis and viability.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
The ability of Mycobacterium tuberculosis to persist in its human host despite extensive chemotherapy is thought to be based on sub-populations of non-replicating phenotypically drug resistant bacilli. To study the non-growing pathogen, culture models that generate quiescent organisms by either oxygen depletion in nutrient-rich medium (Wayne model) or nutrient deprivation in oxygen-rich medium (Loebel model) were developed. In contrast to the energy metabolism of Wayne bacilli, little is known about Loebel bacilli. Here we analyze M. tuberculosis under nutrient starvation conditions. Upon shifting to the non-replicatin...
Source: Microbiology - September 30, 2009 Category: Microbiology Authors: Gengenbacher M, Rao SP, Pethe K, Dick T Tags: Microbiology Source Type: journals
Volatile antimicrobials from Muscodor crispans, a novel endophytic fungus.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Muscodor crispans is a recently described novel endophytic fungus of Ananas ananassoides (wild pineapple) growing in the Bolivian Amazon Basin. The fungus produces a mixture of volatile organic compounds (VOCs), and some of the major components of this mixture are: propanoic acid, 2-methyl-, methyl ester; propanoic acid, 2-methyl- ; 1-butanol, 3-methyl-;1-butanol, 3-methyl-, acetate ; propanoic acid, 2-methyl-, 2-methylbutyl ester ; and ethanol and as determined by gas chromatography/mass spectrometry (GC/MS). The fungus does not, however, produce naphthalene or azulene derivatives as has been observed with many other ...
Source: Microbiology - September 30, 2009 Category: Microbiology Authors: Mitchell AM, Strobel GA, Moore E, Robison R, Sears J Tags: Microbiology Source Type: journals
Expression of phosphofructokinase in Neisseria meningitidis.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Neisseria meningitidis serogroup B is a pathogen that can infect diverse sites within the human host. According to the N. meningitidis genomic information and experimental observations glucose can be completely catabolized through the Entner-Douderoff pathway and the pentose phosphate pathway. The Embden-Meyerhof-Parnas pathway is not functional, because the gene for phosphofructokinase is not present. The phylogenetic distribution of phosphofructokinase indicates that in most obligate aerobic organisms PFK is lacking. We conclude that this is because of the limited contribution of PFK to the energy supply in aerobical...
Source: Microbiology - September 30, 2009 Category: Microbiology Authors: Baart GJ, Langenhof M, van de Waterbeemd B, Hamstra HJ, Zomer B, van der Pol LA, Beuvery EC, Tramper J, Martens DE Tags: Microbiology Source Type: journals
Molecular evidences favouring step-wise evolution of Mozambique Vibrio cholerae O1 El Tor hybrid strain.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
The ctxAB operon coding cholera toxin (CT) in Vibrio cholerae, is carried by the genome of a filamentous phage CTXPhi. Usually, specific CTXPhi infects each of the two important biotypes, classical and El Tor, of epidemic V. cholerae strains belonging to serogroup O1, which are called CTX(class)Phi and CTX(ET)Phi, respectively. However, an unusual hybrid El Tor strain carrying CTX(class)Phi caused cholera epidemic in Mozambique in 2004. To understand its evolution, we have further analyzed some representative hybrid El Tor strains isolated in Kolkata, India in 1992 and the results indicate that both the Mozambique and ...
Source: Microbiology - September 30, 2009 Category: Microbiology Authors: Halder K, Das B, Nair GB, Bhadra RK Tags: Microbiology Source Type: journals
E. coli heat shock proteins, IbpA and IbpB, affect biofilm formation by influencing the level of extracellular indole.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Development of E. coli biofilm requires differential expression of various genes implicated in cell signaling, stress responses, motility, and synthesis of structures responsible for cell attachment. The ibpAB operon belongs to the stress response genes most induced during growth of E. coli biofilm. We demonstrated for the first time that the lack of IbpAB proteins in E. coli cells inhibited the formation of biofilm, although allowed normal planktonic growth. We showed that ibpAB cells experienced endogenous oxidative stress which might result from a decreased catalase activity. The endogenous oxidative stress in ibpAB...
Source: Microbiology - September 30, 2009 Category: Microbiology Authors: Kuczynska-Wisnik D, Matuszewska E, Laskowska E Tags: Microbiology Source Type: journals
DsbL and DsbI Contribute to Periplasmic Disulfide Bond Formation in Salmonella enterica serovar Typhimurium.
Email this article to a colleague.
Save this article to My Clippings.
Discuss or comment on this article.
Disulfide bond formation in periplasmic proteins is catalyzed by the DsbA/DsbB system in most Gram-negative bacteria. Salmonella enterica serovar Typhimurium also encodes a paralogous pair of proteins to DsbA and DsbB, DsbL and DsbI, respectively, downstream of a periplasmic arylsulfate sulfotransferase (ASST). We show that DsbL and DsbI function as a redox pair contributing to periplasmic disulfide bond formation and, as such, affect transcription of the SPI1 type three secretion system genes and activation of the RcsCDB system, as well as ASST activity. In contrast to DsbA/DsbB, however, the DsbL/DsbI system cannot c...
Source: Microbiology - September 30, 2009 Category: Microbiology Authors: Lin D, Kim B, Slauch JM Tags: Microbiology Source Type: journals
